8. Describe the possible outcome of a PCR experiment in which (a) one of the primers is inadvertently omitted from the reaction mixture; (b) one of the primers is complementary to several sites in the starting DNA sample; (c) there is a single- stranded break in the target DNA sequence, which is present in only one copy in the starting sample; (d) there is a double-stranded break in the target DNA sequence, which is present in only one copy in the starting sample. e

8. Describe the possible outcome of a PCR experiment in which (a) one of the primers is inadvertently omitted from the reaction mixture; (b) one of the primers is complementary to several sites in the starting DNA sample; (c) there is a single- stranded break in the target DNA sequence, which is present in only one copy in the starting sample; (d) there is a double-stranded break in the target DNA sequence, which is present in only one copy in the starting sample. e

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 12TYK: Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to...

See similar textbooks

Similar questions

Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.
2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
2) Considering the technologies that pave the way for the identification of molecules on the basis of hybridization in the classical sense, within the scope of Recombinant DNA Technology; (20P) a) Which of these is used to identify which macromolecule,b) What do you understand in the context of hybridization and between which molecules there are technique-specificinteractions take placec) “Nylon membrane” or “nitrosdulose” commonly used in these technologieswhy "membranes" are needed,d) Explain how to design an application example for each technique you mentioned.
1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
1. What is the function of the DNA polymerase enzyme in the PCR? 2. What natural process is PCR based on?
5. Which of the following alternative steps cannot be employed in the DNA extraction because it would cause denaturation of some DNA? a. Using vodka instead of isopropyl alcohol. b. Using warm isopropyl alcohol instead of cold isopropyl alcohol. c. Using ammonium chloride for the soapy salt solution instead of sodium chloride. d. Using unscented and uncolored liquid soap for the soapy salt solution 6. Which property of DNA makes it possible to wrap it around the toothpick? a. DNA has a double-stranded helical structure b. DNA is color white. c. DNA is made up of long and thin strands. d. DNA carries genetic information
1. If you will use apple or strawberries instead of banana do you think the result would be the same in the extraction of DNA from a banana? Why or why not?
1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. If you forgot to add nucleotides to your PCR master mix, which control reaction tube would have results that are different than they would be if you had prepared them correctly? 7. If you found that there was DNA amplification in your negative control tube, what could be an explanation for that result?