Answered: explain the rationales of adding…

explain the rationales of adding chemicals that can affect DNA stability in a polymerase chain reaction (PCR). 2.Why DNA melting is required in PCR?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 4TYK: After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify...

See similar textbooks

Related questions

Q: 5) PCR primers have a melting temperature (Tm) at which they become dissociated from the template…

A: A primer is a short strand of nucleotide molecules that serves as an initial point for the synthesis…

Q: Using the same template strand, transcribe the DNA: GCA TAG CAA TGC

A: Answer: Transcription : It is the process of transcribing DNA to RNA using the template strand of…

Q: Why is Taq polymerase used in PCR rather than other DNA polymerases?a. Taq polymerase is a synthetic…

A: PCR(polymerase chain reaction) is a molecular method to make multiple copies(amplify) of a small…

Q: 6. Which of the following steps are catalyzed by Taq DNA polymerase in a PCR reaction? a.…

A: Polymerase chain reaction can be described as the molecular technique to rapidly synthesize millions…

Q: Identify the CORRECT sequence of steps that occurs during every cycle of PCR. 1. The primers…

A: PCR, short for Polymerase Chain Reaction is a molecular technique in which multiple copies of a gene…

Q: 3. What is in the master mix and why do you need each component? 4. Why do you need to perform PCR…

A: Polymerase chain reaction (PCR) is a molecular biology technique that is used for amplifying the…

Q: 1. Provide one reason to support the creation of a national DNA database and one reason to refute…

A: DNA or deoxyribonucleic acid is the genetic material in all living organisms. Within the cells, DNA…

Q: Describe the effects of the temperature change during polymerase chain reaction (PCR) What are the…

A: PCR (polymerase chain reaction) involves a series of cycles that takes place at multiple…

Q: 33 - The correct procedures for gene cloning are given as a) PCR/transformation/ligation/restriction…

A: Gene cloning is the method of production of numerous copies of a gene fragment.

Q: Explain why phenol:chloroform is used in the isolation of genomic DNA ( What is the end result and…

A: Extraction of genomic DNA is of main importance to study the genetic reasons behind diseases and for…

Q: Give 2 advantages of SPACER DNA SEQUENCES as regions in the genome/chromosome to target for DNA…

A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…

Q: 7. You are tasked with amplifying a fragment of interest from a sample of genomic DNA by using PCR.…

A: PCR stands for the polymerase chain reaction. It is described as a test that is used to detect the…

Q: How do we describe the two strands of DNA, once they have separated during denaturation? 2.…

Q: Describe and contrast the common steps of DNA replication in vivo and the PCR reaction in vitro? 2.…

A: DNA replication occurs at the interphase of the cell cycle. Watson and Crick realized that a single…

Q: What is the difference between an antigen test and a PCR test? a. What are the benefits…

A: PCR- PCR stands for polymerase chain reaction. Antigen test- Antigen tests are immuno-assays which…

Q: 1. If you forgot to add nucleotides to your PCR master mix, which control reaction tube would have…

A: PCR is used for the amplification of molecule of DNA.

Q: Explain how and why a researcher might use a DNA probe.

A: Probes , DNA probes -- Segments of DNA or RNA with the help of which cDNA or RNA segments of any…

Q: Explain how and why PCR can be used to amplify DNA. Describe the steps in the process. Be sure to…

A: PCR stands for a polymerase chain reaction. It is used to amplify the DNA segment. It can make many…

Q: 1-What are the requirements to carry PCR? 2-How amplification will be specific for each step

A: PCR is a polymerase chain reaction that is a technique to amplify the DNA to billions of copies.…

Q: What does the salt in the soapy salt solution do in the DNA extraction? a. It dissolves the DNA. b.…

A: DNA molecule is a negatively charged molecule which is made up of nucleotides. Each nucleotide is…

Q: 5) Which of the following is not a component of a PCR reaction mixture? A) DNA template B)…

A: Polymerase chain reaction (PCR) is a widely used method in molecular biology that is used to make…

Q: 1. What does PCR stand for? 2. Explain the main objective of the PCR technique.

A: PCR It is a technique used in molecular biology which was developed by Kary Mullis, an American…

Q: 6) In automated DNA sequencing a) Radio labelled DNTPS are used b) Radio labelled ddNTPs are used c)…

A: Automated DNA sequencing is used to generate the nucleotide sequence of a given DNA strand. The…

Q: What is the purpose of cell dissolution? 2. What is the purpose of DNA separation? 3. What is the…

A: Cell lysis : The method in which the cell membrane is broken down to release the inter-cellular…

Q: 8- Briefly state why heat-stable DNA polymerase from a thermophilic bacterium is used in PCR instead…

A: Polymerase chain reaction is the method of multiplying an specific sequence of dna to obtain it's…

Q: PCR is quick, efficient and easy to perform. However, there are some situations when cell-based…

A: PCR which stands for polymerization chain reaction is an analytic technique which is used to amplify…

Q: 1. What happens in the denaturing step of PCR? A. What happens during the annealing step of…

A: PCR is used widely in the fields of cell Biology, Forensic Researches, medical diagnostics, and in…

Q: 1) you have a locus in your PCR reaction that is a DNA squence is on the fifth chromosome, is a…

A: Gel electrophoresis is a common laboratory method used for the separation of DNA, RNA, or proteins…

Q: 3. Write a formula to calculate the number of DNA molecules which will be created for a given number…

A: Answer: PCR (POLYMERASE CHAIN REACTION) =This is the tool of molecular biology, in this process a…

Q: Answer the following questions about Extraction of DNA A. (3) types of DNA B. Reagents needed to…

A: Nucleic acids are macromolecules or biopolymers made up of monomers called nucleotides.…

Q: 1. Upon the banana DNA extraction, what do you see in the top portion of the liquid when you look at…

A: DNA (Deoxyribonucleic Acid) is the genetic material of all living organisms whether plant, animal,…

Q: What is the reason that the Taq polymerase is currently used? A the Taq polymerase is one of the…

A: Taq polymerase is obtained from a thermophilic (those organisms which can survive in very high…

Q: What extra step need to be taken after collecting samples of many viruses before PCR can be…

A: The PCR i.e. polymerase chain reaction is performed in 3 basic steps: Collection of samples…

Q: 1 DNA evidence analysis is an imperfect science. Provide two reasons why this may be the case.

A: DNA is the hereditary material present in organisms. It is important for our growth, reproduction,…

Q: PCR is a way for scientists to amplify DNA using primers and a special heat resistant polymerase.…

A: PCR or polymerase chain reaction is a technique in which a part of DNA can be amplified many many…

Q: Think about the function of the primers in a PCR that is designed to amplify a specific sequence,…

A: Polymerase chain reaction is a process to detect the genetic material from a particular organism…

Q: 2. Agarose gel clectrophoresis of PCR products from samples taken from a healthy, a carrier, and an…

A: Mutations are sudden and abrupt changes in the DNA, which can potentially change the cell process.…

Q: 2. Compare the key players in DNA replication, PCR, transcription, and translation by filling out a…

A: The process of creating two identical copies of DNA from the original DNA is known as DNA…

Q: 1) Describe the ingredients of a PCR reaction. List different temperatures used in each cycle and…

A: Answer:- Template DNA, PCR primers - a starting nucleotides sequence pre-requisite for the…

Q: 3- Which of the following is not a basic requirement of PCR? a-Taq DNA polymerase b-DNA Probes…

A: Polymerase Chain Reaction (PCR). Principle: When a double-stranded DNA molecule is heated to a high…

Q: 1. List all the differences between the DNA Polymerase Reaction and Polymerase Chain Reaction (PCR)?

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Predict the effect on the PCR reaction if any of the following circumstances arose: i) there are no…

A: Introduction :- The polymerase chain reaction (PCR) is a technique for amplifying DNA sequences in…

Q: 1. What is DNA cloning of animals and plants? 2. What is the importance of DNA cloning? 3. Give…

A: 1. DNA cloning of animals and plants is a process of creating a genetically identical copy of an…

Q: Find out whether the following are true or false. a)Klenow polymerase is E. coli DNA polymerase I…

A: Polymerase chain reaction involes denaturation, annealing and extension steps at varied temperature…

Q: Why is each of the following reagents required to be in the PCR reaction tube? Primers, Taq DNA…

A: Polymerase chain reaction is used to amplify a piece of DNA manifold. The technique can produce a…

Q: 5. In PCR, what replaces the need for helicase? In PCR, what replaces the need for primase? In PCR,…

A: Polymerase chain reaction(PCR) is a technique of DNA amplification. In this technique, a small…

Q: Make simple steps to extract isolating DNA from strawberries and yeast.

A: Answer

Q: 1.) What are the different temperatures used in PCR (polymerase chain reaction)? What happens at…

A: Polymerase Chain Reaction or PCR is a technique that used for making copies or amplify small…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

1.Briefly explain the rationales of adding chemicals that can affect DNA stability in a polymerase chain reaction (PCR).

2.Why DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Answer 1.

VIEW

Answer 2.

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What information and materials are needed to amplify region of DNA using PCR?
Match the method with the appropriate enzyme. _____ PCR a. Taq polymerase _____ cutting DNA b. DNA ligase _____ cDNA synthesis c. reverse transcriptase _____ DNA sequencing d. restriction enzyme _____ pasting DNA e. DNA polymerase (not Taq)
After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify the DNA. b. convert cDNA into genomic DNA. c. convert cDNA into messenger RNA. d. verify that the desired DNA sequence has been amplified. e. synthesize primer DNA molecules.
1. What is the function of the DNA polymerase enzyme in the PCR? 2. What natural process is PCR based on?
1. What is/are the purpose(s) of DNA extraction? 2. What is the function of each reagent used in the extraction of DNA from a banana? a. Saltwater b. Liquid dishwashing soap c. Cold isopropyl alcohol
1. If you forgot to add nucleotides to your PCR master mix, which control reaction tube would have results that are different than they would be if you had prepared them correctly? 7. If you found that there was DNA amplification in your negative control tube, what could be an explanation for that result?
1.) What are the different temperatures used in PCR (polymerase chain reaction)? What happens at each temperature? 2.) What ingredients are used in PCR? What role does each ingredient have in replicating DNA? 3.) Why is the contamination of foreign DNA a particularly important problem when you do PCR?
1-What are the requirements to carry PCR? 2-How amplification will be specific for each step
1) Describe the ingredients of a PCR reaction. List different temperatures used in each cycle and tell why each is used.
1. What are the reaction components, and what equipment do you need for PCR?2. What can be possible source of DNA for PCR?3. What are some uses for PCR?
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
6. Which of the following steps are catalyzed by Taq DNA polymerase in a PCR reaction?a. Denaturation of template DNAb. Annealing of primers to template DNAc. Extension of primer end on the template DNAd. All of the above Please also explain the answer properly and refer to NCERT XII (chapter 11) textbook.