6. replication? To answer the question please: idraw a scheme of DNA replication and mark the direction of replication fork movement; 21 name the proteins that are required for DNA replication.
Q: Explain why are errors in DNA replication so rare, what enzymatic activity, in addition to…
A: DNA replication: Transmission of chromosomal DNA from generation to generation is achieved when DNA…
Q: List seven enzymes and proteins needed in a DNA Replication. Briefly state their functions
A: DNA is made up of various nucleotides that store genetic information in it. DNA is packed into a…
Q: Think about DNA replication versus RNA transcription - which of the following statements is true…
A: DNA replication is semi conservative, that is, not entire product is similar to template, but it is…
Q: If a bacterial (E. coli) cell has 50,000 bp, how long will be a normal DNA replication?
A: On the chromosome of E. coli, like in most bacteria, there is just one replication origin. The…
Q: 3. The speed of DNA replication at a replication fork is about 100 nucleotides per second (on each…
A: The DNA replication is the process by which new DNA is synthesized from the old DNA by the…
Q: ***10. Fill in the blanks to describe the similarities between transcription and DNA replication.…
A:
Q: True
A: There are three main steps involved in the process of DNA REPLICATION , namely :- INITIATION…
Q: 11. What are the 3 steps involved in replication? Show DNA replication using the following DNA…
A: Genetic information present in double stranded DNA molecule is transmitted from one cell to another…
Q: 10. A replication bubble is shown below, with the origin of replication represented by a black dot.
A: In this question, we have to answer about the process of replication.
Q: State five differences between DNA replication, and transcription in eukaryotes.
A: Note: Since you have posted two unrelated questions, we are solving the first one for you. If you…
Q: 3b) During DNA replication, one new DNA strand is synthesized continuously but the other strand is…
A: DNA is a long polymer of nucleotides which makes the genetic material of most of the living organism…
Q: Briefly explain how the product molecules of rolling circle replication differs from the products of…
A: Gene expression in both prokaryotes and eukaryotes involves different modes of transfer of genetic…
Q: II. The base composition of a single stranded DNA, which is 1000 bases long is the following: A =…
A: A parent DNA molecule makes two DNA double helix in a single round of DNA replication.
Q: 3. Draw the DNA replication process. (label the enzymes and other requirements)
A: Answer : DNA replication process is the three step process which takes place one after another. The…
Q: 2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:) Choose…
A: DNA replication is semiconservative in nature, where each daughter DNA molecule has one parent…
Q: Choose one among the three: DNA replication, transcription, and translation and then discuss its…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: Describe the basic structure of a DNA? Give the different components of DNA and their function in…
A: Genetics is the branch of biology that deals with genetic material like DNA, RNA, inheritance.…
Q: 3. Predict the consequence in the cell if DNA polymerase I is absent during replication
A: DNA replication is a critical component of a cell's life cycle. It is necessary for the cell to…
Q: During DNA replication, helicase breaks the hydrogen bonds and unwind the DNA strands. True False
A: During DNA (deoxyribonucleic acid) replication the genetic material synthesises its copy. The…
Q: Explain how is DNA replicated and repaired?
A: Hi! As you have posted multiple questions and have not mentioned which is to be answered, we are…
Q: 10. Which of the following is the correct sequence of the 3 steps of DNA replication? * the priming…
A: DNA(deoxyribonucleic acid) is a sequence of nucleotides joined together through phosphodiester…
Q: 1. Explain the three phases of DNA Replication of eukaryotic cell as illustrated below and define…
A: DNA Replication is the process through which DNA copies itself. The double stranded molecule…
Q: 1. Explain the comparison and the contrast of DNA and RNA polymerases activity?
A: DNA polymerases are enzymes which are involved in replication of DNA. The DNA polymerase catalyses…
Q: Describe or explain how the presence of a thymine dimer in DNA being used as the template strand…
A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…
Q: AKS 5a: If a DNA strand has 32 % guanine before semi conservative replication occurs, what percent…
A: A single molecule of DNA will have four types of nucleotide bases, adenine (A), guanine (G),…
Q: 2. The organization of DNA requires that replication be performed by a large “machine of proteins."…
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: 4. During DNA replication, half of the strand is conserved in the new molecules created. This is…
A: 4. During DNA replication, half of the strand of conserved in the new molecules created. This is…
Q: Apply all that you have learned to solve the folowng If you have the following DNA sequence…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: AKS 5b: When considering the semi-conservative model of DNA replication, how many of the resulting…
A: Semi-conservative replication This replication describes the method of replication of DNA in all the…
Q: A Scrhserved under a microscope, researchers observe that the DNA is able to be Sephe replicated.…
A:
Q: 9. Below is a schematic of an origin of replication. a) Would replication in the top strand in…
A: The enzyme used for the process of DNA replication is the DNA polymerase enzyme. The characteristic…
Q: What is the role of Ligase in DNA replication?
A: DNA is the genetic material present in the nucleus.
Q: 26- A select mutation is causing a cell lineage to be unable to replicate DNA successfully. When…
A: The process involving a series of steps for the formation of a copy of DNA by the DNA itself (parent…
Q: Discuss the stages or process of DNA and Cell replication. 2. What is DNA repair and discuss
A: DNA is a double stranded molecule which are linked together by hydrogen bonds. DNA replication means…
Q: When DNA replicates, how is it able to “unwind” its double helix?
A: DNA is able to unwind it's double helix with the help of enzyme DNA Helicase.
Q: 33.Choose the DNA nucleotide sequence that would be complementary to the following strand (note: pay…
A: DNA is store house of genetic information. During S phase of cell cycle DNA make its copies to…
Q: 1. For each of the items below, give a brief description (indicate function for enzymes) and…
A: The process of replication and transcription are catalysed by different Enzymes and proteins. The…
Q: 1. Compare and contrast replication, transcription and translation based on the following criteria.…
A: Molecular biology is the branch of science which deals with the study of gene structure and…
Q: A- DNA REPLICATION 1. Use the DNA code provided and fill in the complernent.ary DNA strand. a TAA…
A: As per our guidelines, we are supposed to answer only one question. Kindly repost the other question…
Q: 1. Directly below the DNA nucleotide sequence given below, write/type the complementary nucleotide…
A: 1. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: 1. Compare and contrast replication, transcription and translation based on the following criteria.…
A:
Q: How does the model attached show DNA Replication? What is the importance of DNA Replication? What…
A: DNA act as a very important genetic molecule in living organisms.DNA replication is the biological…
Q: 4.) During DNA replication, the two strands of DNA are pried apart and then serve as templates for…
A: According to our guideline we can answer only the first question. The second question is completely…
Q: 1. Fill in the blanks in the table below regarding the similarities and differences between two…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: 12. A diagram of DNA replication is shown below. Redraw the diagram into copybook and fill in the…
A: DNA replication: a. During DNA replication, an exact copy of DNA is made from the template strand.…
Q: 1. What will happen if there is a mistake in DNA replication? 2. What will happen if there is a…
A: In molecular biology DNA replication is the process in which DNA makes a copy of itself during the…
Q: What is DNA replication? 2. What are the principles of DNA replication?
A: DNA replication DNA , deoxyribonucleic acid , is made up of three components , a deoxyribose sugar ,…
Q: 1. Compare and contrast replication, transcription and translation based on the following criteria.…
A: Gene is the sequence of nucleotides in a DNA which encodes particular protein.
Q: 10. Which model best fits how DNA replicates: Conservative, Semiconservative, or Disperse? *…
A: At each cell division, the DNA making up the chromosome (s) of the cell has to replicate to ensure…
Step by step
Solved in 2 steps with 1 images
- Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.
- 3b) Briefly explain what telomerase does, how it accomplishes what it does, and why that allows a cell to completely and accurately replicate the ends of linear DNA molecules. (please note that the question does not ask you to explain the entire process of replication of the end of a linear DNA strand, it only asks about the function of telomerase in this process)1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?
- The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.DNA Polymerase holoenzymes used for DNA replication recognizes A. double-stranded sequences as starting points B. methylated lipids as start points C. acetylated lipids as start points D. single stranded sequences as starting pointsWhich of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.
- Place the following steps of DNA replication and repair in the correct order by numbering them from 1 to 5. a. A template strand begins to be replicated. b. If the incorrect base is not identified and replaced, it remains as a point mutation in the DNA. c. DNA polymerase identifies and replaces most incorrect bases with the correct base, complementary to the base on the template strand. d. An incorrect base is added to the growing strand of DNA. e. Proteins identify and replace any incorrect bases missed by DNA polymerase.Define the following terms related to DNA replication: origin of replication, helicase, single-strand binding proteins, topoisomerase, primase, RNA primer, DNA polymerase III, DNA polymerase I, and DNA ligase.1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.