On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.

On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.

Name: 1. On a piece of paper, replicate the following segment of DNA:
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’a.) show the direction of replication of the new strands and explain what the lagging and leading strands are.b) Explain

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Similar questions

Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
1. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? a. C b. G c. A d. T 2. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? a. 5' TTACCGAAT 3' b. 3′ AATGGCTTA 5′ c. 5′ TAAGCCATT 3′ d. 3′ TTACCGAAT 5′ 3. This complex assembles and organizes nucleosomes and contributes to gene repression a. SWR1 Complex b. ISWI Complex c. SWI/SNF Complex d. SWI Complex 4. Amino acids at the N-terminal end of eukaryotic polypeptides that contain the information required for the post-translational processing and…
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? Group of answer choices a. 5' TTACCGAAT 3' b. 3′ AATGGCTTA 5′ c. 5′ TAAGCCATT 3′ d. 3′ TTACCGAAT 5′ 2. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices a. C b. G c. A d. T 3. A scientist, Dr. Doom would like to create a novel antibiotic by targeting translation in bacterial cells. Which enzyme(s) would Dr. Doom need to target to prevent translation at the transcriptional stage? Group of answer choices a. RNA Polymerase…
1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?
4) Replication of a circular DNA molecule can occur by either theta replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe the differences between the two - an accurate statement about one form of replication that does not clearly indicate how the other form differs will not answer the qestion in it's entirety).
2. List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'