7. RSV is a and as generated during times of biotic and m. abiotic stress in plants. 8. RSV produced in the root system of plants improves the uptake of. 9. RSV chemically is a s from the soil. regulated by, genes in all grapevine species.

7. RSV is a and as generated during times of biotic and m. abiotic stress in plants. 8. RSV produced in the root system of plants improves the uptake of. 9. RSV chemically is a s from the soil. regulated by, genes in all grapevine species.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter47: Conservation Biology And Biodiversity

Section: Chapter Questions

Problem 9RQ: A secondary plant compound might be used for which of the following? a new crop variety a new drug a...

See similar textbooks

Related questions

Q: Q.3. Explain the terms: 1. Race 2. Breed 3. Cultivars 4. Variety

A: Animal husbandry is the department of science that deals with the exercise of breeding, farming, and…

Q: Phosphofructokinase (PFK) catalyzes a key step in glycolysis. This enzyme is composed of three…

A: The most common causes of anemia in the elderly are chronic disease and iron deficiency. Vitamin B12…

Q: Directions: Read and understand the situation very carefully. Hanabi, a grade 12 student have…

A: The examination of the evolutionary development and connections among or even within groups of…

Q: QUESTION 9 mc The line of evidence used to support the concept of evolution that deals with looking…

A: Evolutionary developmental biology is considered a new norm in evolutionary biology. It arose from…

Q: Describe the club fungus life cycle.

A: Fungi are group of eukaryotic organisms that includes unicellular microorganisms like yeasts and…

Q: For genotype: repP lach lacPt lacO+ lacZt lacY Select the best description of beta-galactosidase…

A: Beta galactosidase is an enzyme which breaks the disaccharide lactose to produce galactos and…

Q: Hydrophobic and hydrophilic: how do aquatic insects locomote on the surface of water?

A: Hydrophilic and hydrophobic The word Hydrophilic is a combination of two words i.e. "Hydro" which…

Q: 13. Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А…

A: A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm.…

Q: Compare the morphological characteristics of different roundworms Ascaris lumbriciodes…

A: Introduction Roundworms:- These are parasites that need to live in the body, it pose a significant…

Q: A 3-point test cross produces the following numbers of offspring: + + a 348 How many double…

A: Test cross is a cross made between f1 (offspring)with its recessive parent to identify the dominance…

Q: Briefly discuss Mendelian Inheritance with that of crossing-over.

A: The Mendelian genetics gives us idea about the inheritance of genetic materials from the parents to…

Q: Explain why the following statement are incorrect.. rewrite them to make it correct 1) evolution is…

A: Evolution can be described as the gradual and continuous change in organisms. It is the process by…

Q: Division of human egg is a) Holoblastic and equal b) Holoblastic and unequal c) Isoblastic d)…

A: Introduction - One of the largest cells in the human body is the human egg, or ovum. It is, however,…

Q: . What is Ringworm? What are the different types of ringworm?

A: Ringworm is a type of skin infection caused by a fungus that affects the skin. It is a contagious…

Q: Q.2. Describe the phenomenon in which two organisms occupying the same geographical area show the…

A: Introduction We will answer the question in below step.

Q: Which of the following statements is true when considering this figure? It represents natural…

A: ANSWER) (f) all of the above are true. The bottle full of marble and and the jar represents the…

Q: true or false: Identical twins are a result of totipotent cells splitting apart after one egg is…

A: Humans are sexually reproducing organisms in which the fertilization and embryonic development…

Q: a. The scale of a spectrophotometer extends from 1 to 100% T, what are the values of these two…

A: Ans a. Absorbance of these two extremes from percent transmittance ( %T) can be calculated by the…

Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…

A: DNA is the protein in all living organisms that convey genetic information.

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: 10. Which of the following sequences would you expect to be a part of a beta turn? PAAG O PAGA O…

Q: A lawyer sets out to prove that a child with type A blood is the son of a man with type B blood and…

A: This question is about genotype and phenotype.

Q: Why do megapodiidae have an incubating egg and what does it do? 2. How does being non-migratory…

A: 1. Megapodes is from family Megapodiidae. It is a fascinating group of birds named for their large…

Q: What is the World Health Organization recommendation for the prophylaxis of rheumatic fever after a…

A: Introduction - When strep throat or scarlet fever isn't treated appropriately, rheumatic fever might…

Q: 10) Fill in the blanks found in the column on the right with the appropriate term(s) from the column…

A: Different types of cells that perform same function and originated from the same embryonic germ…

Q: Which of the following receptors is most implicated in the energy crisis following a concussion?…

A: A concussion is a type of brain injury that can occur after a blow to the head. Concussions can…

Q: 1. A sample DNA was analyzed. 42% of the nucleotides contained Adenine. Calculate the % of…

A: DNA or deoxyribonucleic acid is the molecule present in almost all the living things that code for…

Q: Question 43 The DNA strand that serves as a template during transcription is known (other than…

A: DNA transcription is the process by which the coded information from the genome is sent to the cell…

Q: The enzyme hexokinase adds a phosphate toD-glucose but ignores its mirror image, L-glucose.…

A: Hexokinase is found in all metabolising cells of the body, whereas glucokinase is found in liver and…

Q: 10. Modified true or false: Write T if the statement is true; if false, write F, underline the word…

A: Plants are classified as flowering plants and non-flowering plants. Flowering plants are divided…

Q: (vi) Taqpep is a protease that controls tabby patterning in multiple cat species. A protease is an…

A: The Taqpep is a transmembrane protein of M1 amino peptidase family. It is a protease enzyme means…

Q: Please could you explain how lymphocytes (especially B) can maintain receptors on their surfaces? Is…

A: Lymphocytes are a type of white blood cell that plays an important role in the immune system. They…

Q: Natural selection favored dark-colored fur in the rock pocket mouse. The selective force on the…

A: Natural selection It is a natural biological process where organisms adapt and change there…

Q: Explain the function of a sac fungus ascocarp and how thisstructure forms.

A: Fungi are the world's oldest and largest group of organisms. Fungi are all eukaryotic heterotrophs,…

Q: . How would you “re-create” hexaploid bread wheat fromTriticum tauschii and Emmer?

A: Durum is a form of wheat and is found to be tetraploid in nature. Bread is also a form of wheat and…

Q: How do animals respond to environmental stimuli? How do plants respond to environmental stimuli?

A: Stimulus is basically noticeable / observable changes takes place inside the body of organism . The…

Q: Match the organs with their functions pancreas a. production of saliva b. secretes pancreatic juice…

A: The Digestive System: The digestive system breaks down the food into smaller pieces so that it can…

Q: . In an inversion, is a 5′ DNA end ever joined to another 5′end? Explain

A: A chromosome is generally defined in terms of that they are supposed used as a long DNA molecule…

Q: Can two normal individuals of the same species with sexual reproduction have identical genomes and…

A: Introduction - Sexual reproduction is a type of reproduction that comprises a complicated life cycle…

Q: What are the primary and the secondary constrictions o a chromosome? What is the other name given to…

A: * primary constrictions is the centromere of chromosome and the chromatids of a chromosome attached…

Q: What similarities and what differences between the graphs? What antibiotics were the most…

A: These graphs are based on the observation of bacteria collected from cave and were tested for…

Q: true or false: meiosis takes place in body cells called somatic cells.

A: Meiosis is a double division which occurs in a diploid cell and gives rise to four haploid cells…

Q: Electrical impulses travelling from a point of origin to adjacent regions of the cortex is referred…

A: A sudden uncontrollable electrical disturbance on the brain is known as seizure. Causes change in…

Q: Explain rna splicing in eukaryotes

A: The "translation" is the process through which mRNA codes for a certain protein. The ribosome…

Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…

A: A great number of diseases are caused due to multiple problems. And hypocomplementemia is such…

Q: What are the checkpoints in the completion of the life cycle of nematomorphs? Would it be easier if…

A: The phylum Nematomorpha (also called horsehair worms) is constituted of orders: Nectonematoidea…

Q: 1. Why do loons have difficulty walking on land? 2. Where do baby loons spend most of their time…

A: Introduction Loons are water birds, range in length from 60 to 90 cm (2 to 3 feet)re members of the…

Q: An enzyme that acts as both a kinase and phosphatase in rxn. of 1 uM 1,3-bisphosphoglycerate,…

A: An enzyme that adds phosphate groups (PO43) to other molecules is known as kinase. Kinases are…

Q: What are homologous chromosomes? Which are the human cells that do not have homologous chromosomes?

A: Introduction - Chromosomes are thread-like structures that reside within the nucleus of animal and…

Q: What are the types of evolution

A: The various types of evolution are as follows:

Question

Please answer asap and type your answer and do not copy from anywhere please please be quick

7. RSV is a
abiotic stress in plants.
8. RSV produced in the root system of plants improves the uptake of
9. RSV chemically is a s
and a s_
m
generated during times of biotic and
from the soil.
regulated by.
genes in all grapevine species.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

5. A biotechnologist wants to enhance the size of duhat fruit because research shows that it can lower blood sugar but is very expensive in the market. What could be the possible source of organism which contains the gene that is responsible for the development of large fruits.?A. Lanka. B. Chico. C. Strawberry D. Mango
What are avirulence genes?a. plant genes that encode proteins that prevent infection (virulence)b. plant genes that cause infection when the proteins they encode bindto pathogen elicitorsc. pathogen genes that prevent the pathogens from causing plantdiseased. pathogen genes that encode elicitors that foster diseasein plantse. None of the above correctly describes avirulence genes.
7) Farmers in India have increased the harvest yield of food crops like eggplant by growing them from seeds that have been modified to produce a bacterial toxin that is harmful to pest insects. This is an example of a) selective breeding of the insecticide b) spraying an insecticide on plants c) selective breeding of the eggplant d) an application of biotechnology
1. A young student has recently inherited a rice farm and must decide which kind of planting to utilize. He/she discovered that transplanting or direct seeding might be used from Agri 32. How would you make a decision if you were in his/her shoes? What considerations does he/she have? 2. The same student acquired another 2-hectare property, but this one was near the base of the mountains, and hence had a more rolling landscape. He/she chose to plant coconut palms ten meters apart in a square pattern, with a mango tree in the center of four coconut palms. a. What will be the coconut population density? How many coconut seedlings should he or she prepare for the two-hectare property? With a 10% mortality allowance, how many seedlings should he/she prepare in total? b. If he decides to switch to a triangle planting system, how many additional coconut seedlings should he prepare? c. What number of mango trees should he/she purchase? What is the term for putting a mango tree in the center…
1) genetically modified crops are produced by introducing _______ coding for desired character in plants .Q2) continuous use of fertilizers in area can destroy the soil __________.3) _________ is the science of growing ornamental plants.4) composting done using earthworms is called ______.5) richest component in cereals is __________. PLEAE SOLVE ALL QUESTIONS, EXPLAIN PROPERLY. SINGLE PART SHOULD ALSO BE NOT FROM INTERNET ALL THE BEST
1. Which one of these is a plant micronutrient? zn ni Mn carbon 2. Which of these is a plant micronutrient? C N H B
Most genetically modified crops carry genes for ____. a. making human medicines b. herbicide resistance c. increased yields d. disease and pest resistance e. nutritional enhancement
Cattle in industrial dairy farms are typically given rBST, or recombinant bovine somatotropin. This animal hormone increases a cow's milk production, but there is concern that such hormones may have unforeseen effects on milk-drinking humans. There is no similar concern about plant hormones in the plant foods we eat. Why not?
Nitrogen deficiency stunts plant growth and causes leaves to turn yellow and then die. Why does nitrogen deficiency cause these symptoms? Hint: Think about which biological molecules incorporate nitrogen atoms.
1. What type of soil does munggo beans grow best? A. CLAY SOIL B. SAND SOIL C. LOAM SOIL Explain why
1. This hormone also helps in the plant regulation of body fluid A. Gibberellins B. Ethylene C. Abscisic Acid D. Auxin 2. This TRIGGERS the guard cells daily clocking in every 24 hours A. Aquaporins B. Circadian rhythm C. Abscisic Acid D. Lactic acid
Plant biotechnology can lead to a. increased crop production. b. disease-resistant plants. c. new or improved treatments for human diseases. d. more nutritious crops. e. All of these are correct.