8 7 2 6. 3 4 000 000 DO0

Q: 26. Directions: 1st Fill in the complimentary DNA strand using DNA base pairing rules. 2nd Fill in…

A: Reverse transcriptase, a DNA polymerase which can use either DNA or RNA as a templates, creates…

Q: How do I translate the DNA sequence below: 5'-ATGGCCTGGCATTCA-3' 3'-TACCGGACCGTAAGT-5'

A: DNA stands for Deoxyribonucleic acid. It is a molecule composed of two polynucleotide chains to form…

Q: Which of these molecules is responsible for bringing the correct amino acid to the ribosome? acetyl…

A: Translation is the process by which the cells of the body prepare their own proteins in the…

Q: What happens during transcription? Answer using 3-5 complete sentences and at least 5 of the key…

A: The central dogma states that the pattern of information in our cells is from DNA to make new DNA (…

Q: D. Evaluation (Pagtataya) • Fill in the pill-shaped bubbles in the flowchart using the terms in the…

A: This is the description of gene expression in which a part of the gene is expressed into a…

Q: Let’s practice making a strand of mRNA. Finish what we started: DNA:…

A: Messenger RNA  is a single-stranded RNA molecule that is complementary to the DNA strand of a gene.

Q: 5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several…

A: Introduction Marshall Nirenberg discovered a way to determine the sequence of the letters in each…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Which is NOT a difference between RNA and DNA?  Select one: A. RNA contains uracil; DNA usually…

A: Introduction:  Nucleic acids are molecules that store hereditary information for cellular growth and…

Q: Which of the following are involved in translation? Choose all that apply tRNA DNA ribosome…

A: The correct answer is t RNA, Ribosome, Amino acid, mRNA, rRNA

Q: One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic…

A: DNA is the genetic material in living organisms. It carries instructions for making structural and…

Q: What is the nucleotide order in the complementary DNA strand? Your answer What is the nucleotide…

A: TEMPLATE STRAND - 5’-ATA CCC TCA CCT GGC AAT AAC TGT TCG GAT CAC GAG GGG CCA AAC CCT CTT TAC CAT ATA…

Q: 1. Describe the expirement that allowed researchers to first identify the codon for a specific amino…

A: Genetic code is a set of rules that help in determining how the information present on DNA or RNA is…

Q: Let’s return to your patient with sickle cell anemia.  Below is the RNA sequence from your patient…

A: A)

Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…

A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…

Q: What is the Central Dogma of biology? •. Name FOUR polymers in your body right nOW.

A: Central dogma of biology is the process of synthesizing protein from DNA.It was first proposed by…

Q: 3. Using your Genetic Code, translate and group the following MRNA bases. Example: UAC CAG UGG UUU…

A: a. 5 'CUC GGU ACG UAA UAG AUC UAU CAU CCG AGA CUC UUA AAU 3' ANSWER:  5' Leu Gly Thr Stop Stop Ile…

Q: which does not play a role in translation?

A: The translation is the process in which the message coded by an mRNA is translated into a sequence…

Q: An RNA or DNA molecule is a polymer made of subunits called 22.Which of the following is NOT needed…

A: 21- nucleotide 22-spindle fibers  23- it directs the synthesis of protein  24-the complete…

Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…

A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…

Q: Name 2 differences in the structural features of DNA and RNA and indicate the relevance of each…

A: RNA and DNA are the two types of nucleic acids present in the living system. Nucleic acids are…

Q: 1)Which of these molecules is responsible for bringing the correct amino acid to the ribosome? RNA…

A: Translation is the process by which proteins are synthesized using ribosomes. It takes place in the…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: C. Deepen (Pagpapalalim ng Kaalaman) Let us do the activity below. (50 mins. with provision for…

A: Transcription is the process of synthesis of mRNA from DNA. And the process of synthesis of protein…

Q: Transcription Know the central dogma Where transcription takes place What proteins are used for Know…

A: The central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: Original DNA sequence : T A C A C C T T G G C G A C G A C T Amino acid sequence? Mutated DNA…

A: The proteins are produced from the mRNA sequence by translation process that occurs within the…

Q: DNA 11. A A 12. UC G MRNA 13. U G G tRNA Amino Asparagine Acids 14. 15. ler 3 codons equal one…

A: Messenger RNA (mRNA) is a large family of RNA molecules, which transfer the genetic information…

Q: The coding DNA strand of a gene has the following DNA sequence:  5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…

A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…

Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA MRNA | 1.…

A: Transcription is process of formation of mRNA from DNA template by addition of complementary…

Q: emist 19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: sequence is 3 A DNA sequence before and after rep from left to right. The table below shows which…

A: DNA ( Deoxyribonucleic acid ) is a genetic material in most of organism . It is two stranded ,…

Q: he up with one word, seven letter or more, that can be spelled using only the one letter…

A: Synthesis of proteins from RNA is called translation and synthesis of RNA from DNA is called…

Q: 3. Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human…

A: RT - qPCR - Quantitative reverse transcription PCR (RT-qPCR) is used when the starting material is…

Q: 1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it…

A: # According to our guideline we can answer maximum three sub parts of a questions. So, upload the…

Q: рyrim 1. Distinguish between a purine, pyrimidine, hucleoside, nucleotide, polynucleotide, and…

A: INTRODUCTION DNA and RNA are the nucleic acids found in all organisms responsible for the…

Q: 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.…

A: The double-helical structure of DNA was transcribed into mRNA molecules and these mRNA molecules are…

Q: Build up your DNA Tom there your MRNA and your protelm 3 ATATTIT TACTTCAAACOGATT AUGAAGUUUGGCUAA Met…

A: So, the given DNA sequence is ATTTT TACTTCAAACOGATT In a DNA molecule four base pairs are involved…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’    Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: - up to 2 minutos): Which of the following statements about the genetic code is(are) true? OA Each…

A: Genetic code: It is a dictionary that involves a sequence of nucleotides and amino acids which is…

Q: DNA Template: 5' (?) MRNA (?) 3' 3' GGTCAGATGTGCGCGACGGGCAATCCGCACGTGTCATCAATAGTGCCTTCGTCTGAGATC 5'…

A: DNA subsists inside the nucleus as a double-stranded particle. Some regions of DNA include genes…

Q: Hello,  I have already asked for help with this question but whoever answered it copied the DNA…

A: Gene expression is the conversion of DNA into a biologically functional amino acid polypeptide…

Q: Choose the BEST answers: Transcription begins whe✔ Choose... gene and u DNA polymerase Choose...…

A: When an enzyme known as RNA Polymerase (RNA pol) binds to the template DNA strand and starts to…

Q: What happens during translation? Key Vocabulary from Unit 4.2 Answer using 3-5 complete sentences…

A: Translation The process of making a protein from the information contained in a molecule of…

Q: 1. Using the DNA provided transcribe DNA into mRNA. 2. Use the mRNA strand you created and break it…

A: DNA is the main genetic material present in most organisms and stores all the genetic information of…

Q: 1. When can a mutation on the DNA cause shortening of the translation product? Give a specific…

A: A single nucleotide or nucleic acid can be affected by a point mutation. When one base is replaced…

Q: 5' 3' C Process 1 5° Process 2 5 3'

A: Introduction Transcription:- Synthesis of mRNA from DNA template - Transcription is the process by…

Q: 3. The enzyme responsible for transcribing complementary DNA from mRNA is   DNA Polymerase…

A: 3. the process of transcribing complementary DNA from RNA is called as reverse transcription. this…

Q: Is there a difference between a DNA library and a CDNA library? No, the DNA library contains all the…

A: DNA sequence contains noncoding regions, regulatory regions other than coding regions. These regions…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.