11. The following is a prokaryotic coding strand of DNA. 1. Write out the pre-MRNA transcript. Be sure to label the ends appropriately (N or C or 5' or 3'). 2. Circle the start codon on the MRNA and put a box around the stop codon. 3. Write out the polypeptide (amino acid sequence) of the protein this MRNA. Be sure to label the ends appropriately (N or C or 5'or 3'). DNA coding strand 5'- TGGGGGATACCGCATGCAGGTAGTCTAAGCGAGTGAC - 3' Pre-mRNA Polypeptide

Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…

A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: 1. Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base;…

A: DNA replication is a mechanism that involves breaking and building bonds. Replication occurs in 3…

Q: 1. How many codons are there in the Original DNA sequence? 2. How many codons are there in the MRNA?…

A: Introduction  When a DNA gene is disrupted or damaged in such a way that the genetic message carried…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…

A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…

Q: Which of these molecules is responsible for bringing the correct amino acid to the ribosome? acetyl…

A: Translation is the process by which the cells of the body prepare their own proteins in the…

Q: 2. Another kind of mutation is the so-called frameshift mutation, caused by an insertion or a…

A: Frame shift mutation occurring due to insertion or deletion of single nucleotide will lead to shift…

Q: 7) A strand of MRNA that is 450 nitrogenous bases long will produce a protein containing…

A: Living cells use a collection of rules called the genetic code to translate information found in…

Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF

A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…

Q: 1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of…

A: Defination of the gene :-

Q: 7. Fill in the following table. Acid TRNA MRNAI DNA DNA amino sense anti-sense UGA UGA, Histidine…

A: Transcription: It is the process through which the enzyme RNA Polymerase transfers information from…

Q: The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the…

A:

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…

A: Need to find which of the following is correct regarding RNA polymerase function.

Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG....3' a. Use the genetic code to predict the amino acid…

A: DNA is the genetic material as it contains all the information required to make all the proteins and…

Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…

A: * Types of gene variations  Missence Nonsense Frameshift mutation Insertions Deletions Inversions…

Q: 6. The DNA sequence of a portion of the TEMPLATE strand of a gene is 5'-CAATACGTAC-3'. A. Write the…

A: The Central Dogma theory, in Genetics, states that DNA makes DNA through Replication. DNA makes RNA…

Q: 8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time…

A: Answer :   Given in the image

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…

A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…

Q: 8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size…

A: INTRODUCTION Single nucleotide polymorphism Here in a DNA sequence there is an alteration in the…

Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…

A: "Transcription" and "Translation" are two important processes that take place inside the cell for…

Q: 1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is…

A: Transcription is a process which involves formation of RNA molecules from DNA. One of the DNA strand…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…

A: This question we have to describe about process of translation.

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…

A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…

Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer.…

A: DNA It is a nucleic acid that constitutes two polynucleotide chains that are complementary in…

Q: 2. An mRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…

A: Introduction DNA is the hereditary material in humans and almost all other organisms. RNA is used to…

Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…

A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…

Q: 4. (a) Create the complementary strand for the DNA strand below. Make sure to write the direction of…

A: DNA is a polynucleotide molecule that stores genetic and hereditary information. DNA is a…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Q: What are the components of the initiation complex for translation

A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…

Q: 1. Given the MRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…

A: 1. The messenger RNA (mRNA) is produced by the process of transcription from a double-stranded DNA…

Q: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______…

A: The translation is the process by which protein or polypeptide chain is produced from mRNA. The mRNA…

Q: 9. What is the role ol RNA polymerase? To answer the question please: 1) name three types of RNA in…

A: RNA: It is made up of repeating strands of nucleotides which contain all the three parts (nitrogen…

Q: 3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in…

A: Question 3 A) TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT  m-RNA sequence: AUG GAU CGC GUG UAC AUC CAC…

Q: Discuss the difference between intron and Exon

A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…

Q: 1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction…

A: In a transcription unit; the there are 2 DNA strands. The strand with polarity 3' to 5' is the…

Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…

A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…

Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…

A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…

Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…

A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…

Q: 1. One strand of DNA has the base sequence: C G A T T G G C A G T C A T. Determine the sequence of…

A: According to the question, one strand of DNA with the base sequence is given, we have to determine…

Q: 1) The direction of transfer of genetic information in all living things (as defined in the central…

A: it is the process of conversion of the DNA into the functional product it explains how genetic…

Q: )Which of the following statements are true? Choose all that apply a)There are multiple codons…

A: The DNA expression involves the protein synthesis which involves a series of events primarily the…

Q: 8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume…

A:

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.