Multiple Answer Question (suggested time - up to 2 minuts):Which of the following statements about the genetic code is(are) true?DA Each codon encodes for one particular amino acidOe. Genetic code contains 64 codons in total, with one start codon and three stop codonsOC. Genetic code consists of nucleotide triplets - codonsOD. Genetic code is non-overlappingO E. Genetic code is universal for all living organisms (except for mitochondria)OF. Genetic code is degenerate (redundant)

Genetic code: It is a dictionary that involves a sequence of nucleotides and amino acids which is…

Answered: - up to 2 minutos): Which of the…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Please answer fast A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5’-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3’ 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3’ to 5’ direction? 3'-____ -5' 2) What are the first five ribonucleotides of the mRNA transcript of this gene ? 5'-____-3' 3) What are the first five ribonucleotides following exon 1 in the mature mRNA transcript? 5'-_____-3' 4) What is the 5' UTR of the mature mRNA transcript in ribonucleotides? 5'-_____-3' 5A) What are the first five ribonucleotides of the 3' UTR? 5'-_____-3' B) What are the last five ribonucleotides of the 3' UTR? 5'-______-3' 6) How many amino acids are…
Need help answering these questions: Looking at the picture attached, Notice the indel symbol at location 296 of the query. What is the corresponding amino acid in the subject? How many nucleotides were inserted/deleted here?
Do not answer the missing items in the table attached (They are only there as reference). Instead, answer the questions below this. Thanks!- Why is specific base pairing essential to the processes of transcription and translation?- How many codon/s codes for one amino acid?
Question:- A mixed copolymer was synthesized using 2 parts Cytosine and 1 part Adenine and the resulting mRNA was used for translation. What is the probability of producing the following amino acids? NOTE: Answer in fractions only. 1. Threonine _____ 2. Asparagine _____ 3. Histidine _____ 4. Lysine _____ 5. Proline _____
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
Only answer please, no need to explain… Thank you for your time. i: Modification of the 5 prime ends of eukaryotic mRNA is called? a) Capping b) Polyadenylation c) Splicing d) Transcription ii: Genetic Code is? a) The sequence of Nitrogenous Bases in mRNA that codes for a protein b) Is a Triplet Code c) is Non-Overlapping d) All of these iii. The process of formation of RNA is known as a) Replication b) DNA repair c) Translation d) Transcription iv. Which of the following statement is NOT true regarding transcription/RNA synthesis? a) RNA synthesis occurs in the nucleus b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA c) RNA synthesis requires a short stretch of RNA primers d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesis
Please help me answer the GENETIC CODE problems 1. Describe the expirement that allowed researchers to first identify the codon for a specific amino acid. 2. Which of the following statemts about the genetic code are true and which are false? Please correct each false statement. a. Each codon is composed of four bases b. Some amino acids are represented by more than one codon c.All codon represent an amino acid d. Each living species is thought to have its own unique genetic code. e. The codon AUG at the beginning of a sequence is a signal for protein synthesis to begin at that codon. f. It is not known if the code contains stop signals for protein synthesis. Thank you very much for your help.
Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.
Select the correct terms: The genetic code demonstrates (ambiguity / redundancy) because some amino acids are coded by more than one codon. The lack of (ambiguity / redundancy) in the genetic code is evidenced by the fact that each codon codes for one, and only one, amino acid.
What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and then comment on why it would have survival value. Please keep answer between 2-3 sentences
From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed
INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS