) A bacterial chromosome contains 6.4 million nucleotides of DNA. If synthesis at each replication fork occurs at a rate of 1800 nucleotides per second, how many minutes will it take to completely replicate the chromosome with theta replication? 2) What different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met-Trp-Ile? (Include the stop codon

) A bacterial chromosome contains 6.4 million nucleotides of DNA. If synthesis at each replication fork occurs at a rate of 1800 nucleotides per second, how many minutes will it take to completely replicate the chromosome with theta replication? 2) What different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met-Trp-Ile? (Include the stop codon

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a replication fork is 100,000 nucleotides per minute, how much time will theta replication require to completely replicate the molecule, assuming that theta replication is bidirectional? How long will replication of this circular chromosome by rolling-circle replication take? Ignore replication of the displaced strand in rolling-circle replication.
Does E. coli chromosomal replication always start at one particular site? What is called? If you were given the DNA sequence of E. coli chromosome, would you be able to identify where E. coli chromosomal replication starts? What is the end of E. coli chromosome replication?
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
1.) if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? 2.) The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? 3.) What will be the tRNA anticodon based on your answer in item 2? 4.) what is the amino acid chain that your answer in item 2 will dictate? 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1.
A bacterium synthesizes DNA at each replication fork at a rate of 1500 nucleotides per second. If this bacterium completely replicates its circular chromosome by theta replication in 20 minutes, how many base pairs of DNA will its chromosome contain?
What are the three models of DNA replication? With the aid of illustrations, show how the Meselson Stahl experiment come to the conclusion of one model of DNA replication. Is DNA replication bidirectional? How did you arrive at this conclusion? Explain the bacterial replication model that supports this conclusion.
If the gene for primase were mutated so that no functional primase was produced, what would be the effect on theta replication? On rollingcircle replication?
Which strand(s) in the DNA Replication Fork depicted below represent the parent strands?
If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)
If the gene for primase were mutated so that no functional primase was produced, what would be the effect on theta replication? On rolling circle replication?
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side