overexpressed in nervous tissue cancers, breast cancers, and soft tissue tumors at a frequency of 10-25%. Obtain the sequence of the human paralog MDM4 and the mouse paralog MDM4 and perform multiple sequence alignment together with the original five MDM2 sequences listed in problem 2. Give amino acid ranges of the domains (in human MDM2 amino acid numbers) that are highly conserved within sequences of this entire homolog family. 4. The quagga is an animal indigenous to Africa that is now extinct. It looked partly like a donkey and partly like a zebra. In 1872, the last living quagga was photographed. Mitochondrial DNA was ob- tained from a museum quagga specimen and sequenced. a. Perform a BLAST search with the quagga (Equus burchellii quagga) mitochondrial 125 ribosomal DNA query and find out if the quagga is more closely related to the donkey (Equus asinus) or the zebra (Equus zebra). Support your answer with data. b. Perform a Clustal analysis of mitochondria 12S ribosomal DNA sequences from the three species. Along with the outputted multiple sequence alignment an identity matrix is created. Use the identity matrix to confirm the conclusion you made from the BLAST analysis in part a.

overexpressed in nervous tissue cancers, breast cancers, and soft tissue tumors at a frequency of 10-25%. Obtain the sequence of the human paralog MDM4 and the mouse paralog MDM4 and perform multiple sequence alignment together with the original five MDM2 sequences listed in problem 2. Give amino acid ranges of the domains (in human MDM2 amino acid numbers) that are highly conserved within sequences of this entire homolog family. 4. The quagga is an animal indigenous to Africa that is now extinct. It looked partly like a donkey and partly like a zebra. In 1872, the last living quagga was photographed. Mitochondrial DNA was ob- tained from a museum quagga specimen and sequenced. a. Perform a BLAST search with the quagga (Equus burchellii quagga) mitochondrial 125 ribosomal DNA query and find out if the quagga is more closely related to the donkey (Equus asinus) or the zebra (Equus zebra). Support your answer with data. b. Perform a Clustal analysis of mitochondria 12S ribosomal DNA sequences from the three species. Along with the outputted multiple sequence alignment an identity matrix is created. Use the identity matrix to confirm the conclusion you made from the BLAST analysis in part a.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 18P: Functional Consequences of Y-Family DNA Polymerase Structure The eukaryotic translesion DNA...

See similar textbooks

Similar questions

Functional Consequences of Y-Family DNA Polymerase Structure The eukaryotic translesion DNA polymerases fall into the Y family of DNA polymerases. Structural studies reveal that their fingers and thumb domains are small and stubby (see Figure 28.10). In addition, Y-family polymerase active sites are more open and less constrained where base pairing leads to selection of a dNTP substrate for the polymerase reaction. Discuss the relevance of these structural differences. Would you expect Y-family polymerases to have 3-exonuclease activity? Explain your answer.
6. Explain why both deoxyribonucleoside triphosphates (dNTPs) and dideoxynucleosidetriphosphates (ddNTPs) are used in a Sanger sequencing reaction, with the dNTPs in largeexcess over the ddNTPs.
Recall that Leber congenital amaurosis (LCA), a formof congenital blindness in humans, can be caused byhomozygosity for recessive mutations in the RPE65gene. Recently, a rare dominant mutation in RPE65has been implicated as one cause of an eye diseasecalled retinitis pigmentosa, which is characterized byretinal degeneration that can progress to blindness.The dominant RPE65 mutation is a missense mutation causing amino acid 447 in the polypeptide tochange from Asp to Glu. Little is known about thenature of the mutant protein.a. Do you think that the dominant allele is morelikely a loss-of-function or a gain-of-functionmutation? Explain.b. As described in this chapter, gene therapy for LCAhas been at least partially successful. Do you thinkthat the same kind of gene therapy can be used forpatients with retinitis pigmentosa caused by thedominant mutant allele of RPE65? Explain.
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
>mutant1…
Which statements are true? Explain why or why not.1 In terms of the way it interacts with DNA, thehelix–loop–helix motif is more closely related to the leu-cine zipper motif than it is to the helix–turn–helix motif.2 Once cells have differentiated to their final spe-cialized forms, they never again alter expression of theirgenes.3 CG islands are thought to have arisen during evo-lution because they were associated with portions of thegenome that remained unmethylated in the germ line.4 In most differentiated tissues, daughter cells retaina memory of gene expression patterns that were presentin the parent cell through mechanisms that do not involvechanges in the sequence of their genomic DNA.
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
The human genome contains approximately 106 copies of an Alusequence, one of the best-studied classes of short interspersedelements (SINEs), per haploid genome. Individual Alus share a282-nucleotide consensus sequence followed by a 3'-adeninerichtail region. Given that there are approximately 3 * 109bp per human haploid genome, about how many base pairs arespaced between each Alu sequence?
The estimated size of fusion protein of an antibiotic (540bp) and an anti-inflammatory agent (630 bp). There are an additional 222 bp between the sequences. Assuming the average weight of an amino acid is 114 Da, what is the estimated size of the fusion protein? 53 kDa 44 kDa 59 kDa 159 kDa
Genetics of man question: Provide a brief description of on the SNP for the gene GATA binding protein 3 (GATA3)and as well as the gene .
Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…