Solve all parts otherwise I will downvote If a bacterial genome consists of 13% guanosine nucleotides, what fraction of the genome is made of adenosine residues?O 13%O 87%O 37%O 25%O Cannot be determined from the information givenWhich of the following molecules is most susceptible to random hydrolysis?O None of these; such a reaction requires a specific enzymeO RNAO ProteinO None of these, all of these molecules are stable under physiological conditionsDNA

The question is about the nitrogenous bases that is adenine, cytosine,guanine and thymine ( in RNA…

Answered: a bacterial genome consists of 13%…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 2P

See similar textbooks

Similar questions

The two strands for the helix-shaped DNA molecule are heldtogether by electrostatic forces as shown in class. Due to electron sharing, themagnitude of the net average charge on the H and N atoms, each, is 0.2e. Thenet average charge on the C and O atoms, each, is 0.4e. The distance betweenany two adjacent atoms on the same molecule is 0.1nm. Since electric fieldsdecrease as an inverse square law, they die off quickly with distance. So, theonly fields that really contribute to any given bond are due to the 3 atomsalong the red dotted line in the class diagram (two atoms on one'molecule andone atom on the other molecule).Calculate the electric fields and net force between a thymineand an adenine pair.=Calculate the electric fields and net force between a cytosineand a guanine pair.nConsider the OHN bond in the AT nucleotide. Can theelectric field be zero anywhere along the axis of this bond? If not,explain why not. If so, find where the electric field is zero.
Christian Anfinsen showed that the enzyme Ribonuclease (RNase) is completely inactivated at high concentrations of beta mercaptoethanol (BME). When BME is removed, it restores only approximately 1% of RNase activity. When a very low concentration of BME is added back to RNase, its activity is restored to nearly 100%. Why? a Low concentrations of BME causes disulfide bonds to break, but they randomly reform. b High concentrations of BME disrupt all disulfide bonds, which inactivates the enzyme. At low concentrations all of the disulfide bonds reform and BME acts as a cofactor for the enzyme. c The enzyme is only active when an intermediate number of disulfide bonds exists. which is achieved only at low concentrations of BME. d The low concentration of BME allows the majority of the proteins to adopt their most stable form, which is the active form.
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
. While perusing the E. coli K12 genome sequence,you come across a gene with no known function. Theamino acid sequence of the gene’s protein productshows weak similarities with known porins, proteinsthat cross a cellular membrane to let molecules suchas amino acid or sugar nutrients (or drugs like penicillin) pass through. Some porins are nonspecific and letany solute up to a certain size transit into the cell.Other porins are specific and allow the transit ofcertain sugars but not others. What genetic experiments could you do to try to determine whether thisnew gene has a specific function in allowing bacterialcells to scavenge the sugar maltose from the environment? Describe scenarios that might complicate yourexperimental approach.
Bacteriophage T7 helicase movesalong DNA in the 5' -to-3' direction.Other helicases have been reportedto move in the 3' -to-5' direction. Isthere any fundamental reason why you would expect helicases to move in one direction or the other?
Deinococcus radiodurans, which the Guinness Book of World Records has dubbed the world’s toughest bacterium, can tolerate doses of ionizing radiation ∼3000-fold greater than those that are lethal to humans (it was fi rst discovered growing in a can of ground meat that had been “sterilized” by radiation). It appears to have several strategies to repair radiation damage to its DNA (which large doses of ionizing radiation fragment to many pieces) including a particularly large number of genes encoding proteins involved in DNA repair and 4 to 10 copies per cell of its genome, which consists of two circular chromosomes and two circular plasmids. Yet, these strategies, alone, do not account for D. radiodurans’ enormously high radiation resistance. However, in an additional strategy, it organizes its multiple identical dsDNA circles into stacks in which, it is thought, the identical genes in the neighboring circles are aligned side by side. How would this latter strategy help D. radiodurans…
SCIENTIFIC INQUIRY Knowing that the genetic code is almostuniversal, a scientist uses molecular biological methods toinsert the human β-globin gene (shown in Figure 17.12) intobacterial cells, hoping the cells will express it and synthesizefunctional β-globin protein. Instead, the protein produced isnonfunctional and is found to contain many fewer amino acidsthan does β-globin made by a eukaryotic cell. Explain why
Nitrogen and carbon are more abundant in proteinsthan sulfur. Why did Hershey and Chase use radioactive sulfur instead of nitrogen and carbon to label theprotein portion of their bacteriophages in their experiments to determine whether parental protein or parental DNA is necessary for progeny phage production?
5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives the following amino acid sequence: HPIAVRILS What triplet of nucleotides (in other words, what DNA codon) represents the amino acid "P" (proline)? a) 5' GTA 3' b) 5' CAT 3' c) 5' CCT 3' d) 5' ATC 3'
In a pUC19 digest for 1 ug of pUC19 (DNA conc. 282ng/ul) using 10X Cutsmart buffer, pure water and BamHI enzyme in a total volume of 40 ul, how much of each solution is added to the total volume?
Genes participating in informational processessuch as replication, transcription, and translation aretransferred between species much less often than aregenes involved in metabolism. The basis for this inequalityis unclear at present, but one suggestion is that it relatesto the underlying complexity of the two types of processes.Informational processes tend to involve large aggregatesof different gene products, whereas metabolic reactionsare usually catalyzed by enzymes composed of a singleprotein. Why would the complexity of the underlying pro-cess—informational or metabolic—have any effect on therate of horizontal gene transfer?
In each case, these are enzymes that catalyze thesame reaction in different species. The question is: are they related or not? i.e. Are the structures essentially the same? Often you can get similar reactions from proteins thatevolved from a common ancestor (e.g., trypsin and chymotrypsin). Sometimes the samereaction can be catalyzed by proteins with very different evolutionary origins and with verydifferent structures (e.g., trypsin and subtilisin). Your job is to decide if these proteins have fundamentally different folds or if they have basically the same fold. Briefly justify your answer.1. Aminopeptidases from a mammal (PR1A) and the malaria parasite (PR1B)2. Bisphosphoglycerate mutase from a mammal (PR2A) and the toxoplasma parasite(PR2B)

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS