5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives the following amino acid sequence: HPIAVRILS What triplet of nucleotides (in other words, what DNA codon) represents the amino acid "P" (proline)? a) 5' GTA 3' b) 5' CAT 3' c) 5' CCT 3' d) 5' ATC 3'

5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives the following amino acid sequence: HPIAVRILS What triplet of nucleotides (in other words, what DNA codon) represents the amino acid "P" (proline)? a) 5' GTA 3' b) 5' CAT 3' c) 5' CCT 3' d) 5' ATC 3'

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 21CTQ: A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is...

See similar textbooks

Related questions

Q: A TRNA molecule with the anticodon UGC would be carrying the amino acid: Second base of codon…

A: tRNA brings its amino acid to the mRNA in a specific order. This specific order can be determined by…

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: Write the detail or exact information of the following of molecule “X” with UniProtKB accession…

A: Hello, thank you for your question. As per our guidelines, I am answering only the first three…

Q: 1.) What do the first four letters represent in the polypeptide sequence of SARS-CoV-2 surface…

A: Since you have posted multiple questions, we will answer the first one for you. If you want a…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine, The possible codons can be CCG CGC GCC GGC GCG CGG

Q: Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a…

A: The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Q: A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . .…

A: The mutation occurs when there is an error in the sequence of the DNA. It could be because of the…

Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5

A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…

Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be…

A: Usually Central dogma of Molecular Biology is followed during the process of protein synthesis which…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: Remembering that the wobble base of the tRNA is the5′ base of the anticodon:a. In human tRNAs, what…

A: The anticodon of transfer ribonucleic acid is used for carrying the amino acids from the amino acid…

Q: The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S…

A: Ribosomes are complex molecules that are composed of ribosomal RNA molecules where photosynthesis…

Q: 1. Here is the amino acid sequence of part of a hypothetical gene you want to clone:…

A: The degeneracy of the genetic code explains that most of the amino acids defined by more than one…

Q: which signal serves a similar function as the Shine-Dalgarno Sequence in prokaryotes? A. The…

A: The Shine–Dalgarno sequence is a ribosomal binding site in prokaryotic mRNA, generally located…

Q: Which of the following pairs of sequences might be found at the ends of an insertion sequence? a.…

A: Insertion sequence (IS) is defined as a short sequence of DNA acting as a transposon (jumping gene…

Q: The following DNA sequence is part of one exon and contains the beginning of a gene’s open reading…

Q: In an ongoing research of the Philippine Genome Centre, using a repeating copolymers, ACA....…

A: A copolymer is a polymer made up of two or more species of monomer. Periodic copolymers are made up…

Q: Here is the amino acid sequence of part of a hypothetical gene you want to clone:…

A: a.The amino acid sequence Tyr-Met-Cys-Trp-Ile will make a 14-mer probe with the least degeneracy as…

Q: How many possible open reading frames (frameswithout stop codons) exist that extend through the…

A: In molecular genetics, an open reading frame (ORF) is the part of a reading frame that has the…

Q: For the following five sequences, what is the consensus sequence? 5′–GGGAGCG–3′ 5′–GAGAGCG–3′…

A: Consensus sequences models are most used methods for sequencing base sequences. Consensus sequences…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…

A: Option 1 i.e. 5' AUA 3' is the correct answer.

Q: Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…

A: The central dogma of life includes the following processes: Replication: In this process, the DNA…

Q: Which of the following is the consensus sequence of the Kozak sequence?. O 5'AGGAGGU 3' 0 5 ТАТААТ…

A: Please follow step 2 for detailed explanation.

Q: 4. A protein is found with the sequence Met-Thr-Tp-Phe-Lys-Cys-Arg-His-Pro-Gly, A mutant is found…

A: Mutations are change in the nucleotide sequence which results in abnormalities in the protein…

Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…

A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…

Q: What is unusual about the answers for Questions 13k, 13l, 13m, and 13n? Because the multiple codons…

A: Triplets of nucleotides are called codons which specifies individual amino aids in a polypeptide.…

Q: Let’s suppose a researcher mixed together nucleotides with the following percentage of bases: 30% G,…

A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: Structural analysis of bacterial release factor 1 (RF-1) and release factor-2 (RF-2) reveals that…

A: Structural analysis of bacterial release factor 1 (RF-1) and release factor-2 (RF-2) has revealed…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a…

A: The DNA is transcribed into to an RNA by the process of transcription. Following the transcription…

Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA is as follows_ 3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: From the given DNA base sequence indicated below:…

A: The process by which the information contained in the DNA is converted to RNA is referred to as…

Q: If an RNA molecule could form a hairpin with asymmetric internal loop, as shown in Figure Q6–5,…

A: The nucleic acid is a significant macromolecule found in all living organisms. The molecule is…

Q: Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write…

Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following…

A: Answer. A genetic code is a triplet code called a codon. A given amino acid can be specified by more…

Q: n the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding…

A: There are two types of the strand, i.e., the coding strand and the template strand present in the…

Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…

A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…

Q: Which of the following initially comes directly in contact with the mRNA during translation? a. 60s…

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a.…

A: Nucleotides The bases found in the molecules of DNA are known as nucleotides. They are the building…

Q: 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU…

A: DNA replication is a proces by which molecule of DNA is duplicated. DNA replication is necessary to…

Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…

A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…

Question

5' ACTGAGGATTCGGACAGCAATAGGATG 3'

When translated, the -1 reading frame of the sequence above gives the following amino acid sequence:

HPIAVRILS

What triplet of nucleotides (in other words, what DNA codon) represents the amino acid "P" (proline)?

a) 5' GTA 3'

b) 5' CAT 3'

c) 5' CCT 3'

d) 5' ATC 3'

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Ser a. What sequence of five amino acids would give a 14-merprobe with the least degeneracy for probing a library tofind your gene of interest? Notice that you do not use thelast base in the fifth codon because of its degeneracy. b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly? c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.
5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′
What will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5) If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5) What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)
You discovered a (tiny) novel protein and figured out that the protein sequence was: Met-Ala-Arg-Gly-Trp-Ala-Pro Work backwards (showing your work) to identify 2 possible DNA sequences that might encode your protein. Sequence 1: ______________________________________________________________________ Sequence 2: ______________________________________________________________________ Based on these sequences, is there anything you could infer about where this organism might live? Could the DNA in your possible sequences be beneficial for any particular environments?
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
For the following five sequences, what is the consensus sequence? 5′–GGGAGCG–3′ 5′–GAGAGCG–3′ 5′–GAGTGCG–3′ 5′–GAGAACG–3′ 5′–GAGAGCA–3′ a. 5′–GGGAGCG–3′ b. 5′–GAGAGCG–3′ c. 5′–GAGTGCG–3′ d. 5′–GAGAACG–3′
What would be the most likely effect of moving the AAUAAAconsensus sequence shown in Figure 14.7 10 nucleotides upstream?