A biotech company develops a biosensor that measures the presence of proteins activated by growth factor signaling cascades. Which binding domain would you use to each of the following activation peptides or signaling molecules. ◆ Phosphotyrosine A. SH2 Domain A peptide with the sequence Arg-Ala-Pro-Pro-Leu- B. Bromodomain Pro C. 14-3-3 Domain ◆ Phosphatidyl inositol Triphosphate (PIP3) Phosphoserine ◆ Acetylated Lysine D.PH Domain E. SH3 Domain
Q: asap please.
A: Biosensor Biosensor are a analytical tool or device which is used for detecting chemical that is…
Q: This experiment separates meat into an acetone-soluble part and an acetone-insoluble part. The…
A: Explanation: Meat has a lot of water, which is acetone soluble. Because of this, the experiment's…
Q: Which of the following is true about nucleosides and nucleotides? Choose all that apply. A…
A: Nucleoside consists of a nitrogenous base covalently attached to a sugar. Nucleotide consists of…
Q: 3. For every 3 turns of the Calvin Cycle, 1 molecule of G3P (Glyceraldehyde-3-Phosphate) is…
A: Photosynthesis is a process by which green plants prepare their food in the form of glucose by using…
Q: Possible answers for each: A) Both hormone and a neurotransmitter. B) Hormone. C) Neurotransmitter.…
A: Hormones only work once they "fit" a part of the body. That is, if cells within the target…
Q: Describe how a nuclear protein is made and transported to its final destination.
A: Proteins are 3-dimensional structures that are involved in various functions in our body. Proteins…
Q: Question 9 of 14 Which of the following acts as a signal for the dendritic cell to begin…
A: Cross-presentation is the process by which specific MHC class I-expressing professional…
Q: Which of the following is not an example of artificial selection? (a) Your younger sibling got a…
A: Artificial selection is performed by humans. They try to breed the animals or plants in captivity,…
Q: What is similar among the following animals: chimpanzee, Rhesus monkey, dog, mouse, and rat. Are…
A: Different animals are classified on the basis of their morphological characteristics and…
Q: The girl is focusing a slide and she is turning the coarse adjustment knob up toward the slide. A.…
A: An optical microscope has the following parts:- A stage for placing the slide A set of objective…
Q: Monophyletic groups are desirable in classification as they Select one: a.reflect evolutionary…
A: Monophyletic group has all descendants taxons from a single common ancestor. Classification is…
Q: If the DNA was replicated using the dispersive model, what would you have expected to observe in the…
A: 3 theories for DNA replication Conservative: According to this theory, the parent molecule is re…
Q: What is meant by the term “intermediate fossil” when referring to the fossil record?
A: A fossil record is the history of life that is documented by fossils. An intermediate fossil is also…
Q: How science affected the life of a student?
A: Today is a age of science and technology. A modern man cannot live his life without applying science…
Q: species are most broadly distributed, which have the smallest range? List at least 3 names per each…
A: Species of organisms are distributed worldwide according to their adaptation ability and the…
Q: Assuming all the genes assort independently, what proportion of the offspring from a cross between…
A:
Q: Proteasome inhibition might lead to an immediate ________ Select one: a. increase in cysteines b.…
A: Proteasome works in conjunction with ubiquitin. Proteasomes are found in the cytosol, both free and…
Q: Which of the following statements about convergent evolution is true? (a) It demonstrates how…
A: Evolution means an organism is keep evolving or bettering itself during the course of time. The gene…
Q: 6. When comparing genes that are conserved between species, the exons are more likely to be related…
A: Exons are nucleic acid coding sequences that are found in mRNA. Introns are non-coding sequences…
Q: Understand the different types of poliovirus vaccines that are used in the USA versus other parts of…
A: Polio is a very dangerous infection that paralyses muscles, including those used for breathing and…
Q: what is the function and origin of this DNA sequence (use BLAST and NEBcutter)?…
A: Introduction Genes are the main regulatory sequence of nucleotides found in the nucleus which…
Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…
A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…
Q: How do organisms with less complex systems such as those in protozoans are able to respond to…
A: Introduction Stimuli are detectable change in the internal or external environment. which causes a…
Q: How would you design an experiment to determine whether two populations of snakes are distinct…
A: The most frequently recognised species idea is the biological one. Interbreeding is used to define…
Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…
A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…
Q: You have aseptically inoculated an unknown organism on a blood agar plate. You return 48 hours later…
A: The unknown organism on a blood Agar plate would cause hemolysis which is the destruction of red…
Q: A scientist investigating the genome of two related individuals observes a difference of a few…
A: Mutation Change in the sequence of DNA is known as mutation.
Q: This is a molarity problem that I cannot figure out. If you could please help me understand the…
A: To create a solution with a lower concentration, a specific volume of the stock solution is mixed…
Q: compare eukaryotic and prokaryotic cells
A: Prokaryotic And Eukaryotic Cells Prokaryotic cells, which comprise bacteria and blue green algae,…
Q: 11. Vitamin B12: coenzyme form, functional groups, mechanism of action, biological role, sources,…
A: A vitamin is an organic molecule that is an essential micronutrient that an organism requires in…
Q: How is the booby’s ritual dance a prezygotic reproductive barrier?
A: Reproductive isolation is necessary for organisms to separate from their shared ancestors and propel…
Q: Why are the similarities among organisms during early development evidence for evolution? Give an…
A: Evolution is the gradual change in the inherited traits of natural populations over many…
Q: Why do vancomycin-resistant bacteria have a higher frequency in the population after treatment with…
A: Vancomycin is a drug that is used to treat infections caused by bacteria. It works by killing the…
Q: Question 6 The genetic code is considered redundant because: It is prone to mutations The same mRNA…
A: Introduction: The creation of a polypeptide by messenger RNA (mRNA) is known as translation. The…
Q: Which among the parameters measured influences one another or are dependent with one another?
A: Variables In research, "variables are the things you want to study , control , measure and…
Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…
A: The phylogenytic tree represent the relationship between different organisms and also gives us idea…
Q: 4. What is genetic drift? Genetic drift is a mechanism beside natural selection that can bring about…
A: Evolution is defined as the change in frequency of alleles in a population over time.
Q: What hypoth generation 0 the coefficier 1, 2, 3 and 4.
A: Consanguinity is the coupling of two people who are second cousins or even closer in relation. Based…
Q: Channel gating – Carrier-mediated transport
A: Channel Gating : It is defined as the process of encoding of biological signals as a change in…
Q: List the phylum for the species, and assign the following structures to the correct phylum and…
A: We are allowed to do upto three sub part of a question. Please repost the undone questions again.…
Q: Why is it important for the sperm in internally fertilizing animals to undergo acrosome reaction at…
A: The acrosome reaction that occurs after sperm capacitation, is an exocytotic event induced by a Ca++…
Q: What factors must be present for allopatric speciation to occur?
A: speciation is the process of evolution in which new, different species are formed. A single…
Q: In mice, genes R and T are 30 m.u. apart. If a mouse with genotype Rt/rT is crossed with a mouse…
A: Linked gene When two different gene located on the same chromosome then it is said they are linked.
Q: A. Predict the pressure of nitrogen gas at T =-98 K and v=0.00375 m³/kg on the basis of (a) the van…
A: The symbol p or P is typically used to indicate pressure. It will calculate the force per unit area…
Q: Genetically modified foods are products produced from organisms that have had genetic modifications…
A: Genetically modified foods are produced by genetic engineering techniques. Scientists modify their…
Q: Why do water-dwelling animals have thicker bones than land-dwelling animals?
A: Bones are the organs of support and form the part of skeletal system. These maintain the body shape…
Q: How many species are present at year 1000? Justify your answer (i.e., clearly explain your…
A: The term species can be defined as a group of individuals that are able to inbreed. Speciation is…
Q: Reduced tailbones and the associated remnant muscles in humans are an example of what type of…
A: Common descent means common ancestory. Various evidences for the same are homologous organs,…
Q: c. MPN = Tube Original sample 10-¹ 10-² 10-3 10-4 10-5 10-6 Dilution factor 1 1/10 1/100 1/1000…
A: Introduction No of bacteria present in a sample can be estimated by MPN (most probable number)…
Q: 2. What link of a contour of biological regulation provides possibility of regulation "on a…
A: Introduction The contour of biological regulation:- It is a way for information processing &…
Step by step
Solved in 2 steps
- Put the following steps for the outline of the growth factor signaling pathway in order: Map Kinase Kinase is Phosphorylated Proteins involved in gene transcription are activated Growth factor binds to its receptor in the cytoplasmic membrane Receptor recruits adaptor protein and GEF Autophosphorylation of tyrosine residues on the receptor Structural change of the receptor activates Tyrosine Kinase Map Kinase Kinase Kinase is phosphorylated Ras, a small GTPase, is activated by the exchange of GTP for GDP Map Kinase is Phosphorylated Map Kinase enters the nucleusEven in the presence of a Ras-GAP, a single amino acid change in as renders it incapable of hydrolyzing GTP. This mutation is known as Ras+ and is a cancer-causing mutation. What effect do you think this mutation will have on signaling downstream of Ras+? Why? a)A mutation would turn on the signaling pathway all of the time. b)Even if a route is mutated, it can still be turned on or off. c)Due to a mutation, the signaling pathway would always be off.EGF signals by binding to cell surface EGF receptors. Which of these observations, if true, would BEST explain EGF’s mechanism of action? A. EGF is hydrophilic and can easily diffuse through the cell membrane B. EGF is hydrophobic and can easily diffuse through the cell membrane C. EGF is hydrophilic and cannot diffuse through the cell membrane D. EGF is hydrophobic and cannot diffuse through the cell membrane
- A mutated form of the α subunit of the heterotrimeric G protein has been identified; this form readily exchanges nucleotides even in the absence of an activated receptor. What would be the effect on a signaling pathway containing the mutated α subunit?Describe two roles for polyubiquitinylation in the NF-κB signaling pathwayGPCR: What would the following mutation mean for the status of the signaling pathway, and the generation of cAMP from ATP? 1) G-protein coupled receptor (GPCR) Loss of Function, in combination with Gain of function of PKA catalytic subunitsa) Pathway ON (final output achieved)b) Pathway OFF (no final output)c) cAMP generatedd) cAMP not generated 2) G-protein coupled receptor (GPCR) Gain of Function, in combination with Loss of function of PKA catalytic subunitsa) Pathway ON (final output achieved)b) Pathway OFF (no final output)c) cAMP generatedd) cAMP not generated
- which of hthe following would result in a persisting proliferation response to growth factor receptor activation after the ligand is no longer binding to its rceptor kinase? 1. Both a mutation that blocks the GTPas activity of Ras and a mutation that blocks the exchange of GDP with GTP would cause the response to persist. 2. a mutation that blocks the GTPas activity of Ras 3. neither a mutation that blocks the GTPas activity of Ras nor a mutation that blocks the exchange of GDP with GTP would cause the response to persist 4. a mutatiaon that blocks the exchange of GDP with GTPexplain the following prperties of G protein: structure of G- activation cycle and signaling pathway for GaqUse your knowledge of Cell & Molecular Biology to design solutions for treatingCOVID-19 based on your understanding of the signaling pathways
- Binding EGF to the EGF receptor causes phosphorylation of tyrosines on the cytoplasmic tail of the receptor. Which of the following best describes the mechanism by which this phosphorylation activates downstream signaling complexes? Select one A. Causes degradation of receptor by proteasome pathway B. Causes EGF receptor to be internalized so it can interact directly with downstream signaling molecules C. Tyrosine phosphorylation alters 3D structure of downstream signaling proteins causing them to change from an inactive to active conformation D. Causes release of EGF from receptor E. Alters the localization of downstream signaling partners in the cytoplasmIn a clinical study, it was found that copaiba essential oil positively regulated multiple signaling pathways in neuronal cells. These included the following signaling pathways which regulate neuronal metabolism, proliferation and immunity: (Select all that apply.) Choose at least one answer. a. AMPK b. pI3K/Akt/mTOR c. MAPK d. JAK/STATDescribe the mechanisms that limit signaling by the phosphoinositide pathway.