A small section of bacterial DNA antisense strand has the following nucleotide sequence: GCC CAC GCA CCT The tRNA anticodons for the gene sequence shown above is Select one: a. CGG GUG CGU GGA b. GCC CUC GCU CCA c. GCC CAC GCA CCU d. CGG GTG CGT GGA

A small section of bacterial DNA antisense strand has the following nucleotide sequence: GCC CAC GCA CCT The tRNA anticodons for the gene sequence shown above is Select one: a. CGG GUG CGU GGA b. GCC CUC GCU CCA c. GCC CAC GCA CCU d. CGG GTG CGT GGA

Name: A small section of bacterial DNA antisense strand has the following nu
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A small section of bacterial DNA antisense strand has the following nucleotide sequence: GCC CAC GCA CCT The tRNA anticodons for the gene sequence shown above isSelect one:a. CGG GUG CGU GGAb. GCC CUC GCU CCAc. GCC CAC GCA CCUd. CGG GTG CGT GGA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

A small section of bacterial DNA antisense strand has the following nucleotide sequence:AAT CGG TCC TCGThe tRNA anticodons for the gene sequence shown above is a. TTA GCC AGG AGC b. AAU CGG ACC ACG c. AAU CGG UCC UCG d. UUA GCC AGG AGC
A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence: CGA AAA GAG AAT A mutation in the above sequence involved a substitution of a single base, resulting in an incomplete protein due to a nonsense mutation. Which of the following gen sequences exemplifies the mutation described above? a. CGA UAA GAG AAT b. CGA AAA AAG AAT c. CGA AAA GAG ACT d. UGA AAA GAG AAT
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCU
A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA Which of the following mutations would cuase a silent mutation in the sequence shown above? a. Replacement of second adenine base with thymine base b. Replacement of first thymine base with adenine base c. Replacement of second guanine base with cytosine base d. Replacement of first cytosine base with guanine base
A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. CGA UUU GGU UGA b. GCU AAA CCA ACU c. GCA AAA CCA ACT d. CGA TTT CCA ACT
A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: GTT GTC CAC TCGA mutation in the above sequence involved the deletion of a single base, leading to a shift in the reading frame of the gene, resulting in an incomplete protein. Which of the following gene sequences exemplifies the mutation described above? Select one: a. TT GTC CAC TCG b. GTT GAT CCA CT c. GT ATC CAC TCG d. ATT GTC AC TCG
A small section of bacterial enzyme has the amino acid sequence arginine, threonine, alanine, and isoleucine.The tRNA anticodons for the amino acid sequence shown above is a. GCA UGC CGA UAC b. GCC UGA CGU UAG c. CGA AGA GCC AUA d. GCG UGG CCC UAA
σ factors bind to what types of sequences on DNA? a. Shine-Delgarno sequences. b. TATA box regions. c. -10 and -35 sequences. d. None of the above.
A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: GTT GTG ACG TAA A mutation in the above sequence involved a substitution of a single base, but did not affect the protein produced when the gene involved was transcribed and translated. Which of the following gene sequences could have the mutation described above? a. GTT GTG ACA TAA b. GTT GGG ACG TAA c. GTA GTG ACG TAA d. GTT GTG ACT TAA
A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence? 5′ –ATGATACTAAGGCCC–3′
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?