Of the following DNA sequences which would you expect to have the highest melting temperature in its double stranded form? For brevity, I have provided the top strand only in the 5' to 3' orientation. TCAGACAG АТАСТАТС

Of the following DNA sequences which would you expect to have the highest melting temperature in its double stranded form? For brevity, I have provided the top strand only in the 5' to 3' orientation. TCAGACAG АТАСТАТС

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Related questions

Q: ) *When double-stranded DNA is heated, the two strands separate into single strands in a process…

A: Factors affecting Tm The temperature at which half of the dsDNA is denatured is called T_{m}…

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: Which of the following is correct according to the DNA base-pairing rules? O a. A+Gequals C+T O b.…

A: DNA or deoxyribonucleic acid is the genetic material found in most eukaryotes. It carries the…

Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…

A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…

Q: Which of the following sequences on a DNA moleculewould be complementary to GCTTATAT?a. TAGGCGCGb.…

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. It contains all genetic information that…

Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: If the sequence of bases in one strand of DNA is 5′ TAGCCT 3′,then the sequence of bases in the…

A: Answer is c.) 3'ATCGGA5'.

Q: If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand…

A: DNA is double stranded where the two strands are antiparallel and follows complementary base…

Q: Which of the following is correct according to the DNA base-pairing rules? O a. A= G O b. A= C O c.…

A: Nucleotide bases are arranged in a proper sequence. There are four nucleotide sequences out of which…

Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: A DNA strand has the following sequence: 5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’ In which…

A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…

Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT

A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: The DNA is composed of purines and pyrimidines. The purines in DNA are adenine and guanine. The…

Q: Which of the following relations will be true for the percentage of bases in double-stranded DNA? a.…

A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: Melting temperature is the temperature at which a double-stranded molecule of DNA is broken down…

Q: Which of the following changes occur with a double-stranded DNA if it is heated to 95°C at neutral…

A: The hereditary substance found in practically all species is DNA or deoxyribonucleic acid. DNA aids…

Q: which type of base pairs uf any allow the dna to remain double dtranded at higher temperature? gc…

A: DNA is the main store house of genetic information in our body. DNA condensed to form chromosome,…

Q: One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on…

A: In a DNA molecule each deoxyribonucleotide is made up of a sugar, nitrogenous base and phosphoric…

Q: The compound known as nitrous acid is a reactive chemical that replaces amino groups (NH2) with keto…

A: Nitrous acid, a potent chemical mutagen, exerts its effect by the deamination of the amino groups of…

Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…

Q: Shown are several single stranded DNA sequences written in the 5' to 3' direction. Which of the…

A: A hair pin structure will be formed due to internal base pairing in a DNA molecule.

Q: The composition (mole fraction) of one of the strands of a double-helical DNA is (A] = 0.3, and (G]…

A: Given; [A]=0.3 and [G]=0.24 We have to follow Chargaffs rule here; A+T=G+C A forms 2 H bonds with T…

Q: All of the following statements are correct EXCEPT a. DNA forms described by Watson and Crick have…

A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…

Q: For a double stranded coding region DNA transcribed from left to right and whose top strand is…

A: There are two strands of DNA. One strand goes from 5' to 3' and the other strand goes from 3' to 5'.…

Q: For numbers 1-3 refer to the statement: The following is the base sequence on one strand of a DNA…

A: "Since you have asked multiple questions, we are eligible to answer only the first three parts.…

Q: A-DNA is a double-stranded form of DNA that has a helical radius and helical pitch compared to the…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…

A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…

Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…

A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: Question mentioned in the attachment

A: B form of DNA is considered a right-handed double helix DNA. It tends to runs in opposite directions…

Q: The sequences of four DNA molecules are given bel ii. TTTCCCGGGAAA AAAGGGCCCTTT iv. GCCGGATCCGGC…

A: DNA molecules are the nucleic acids that contain sugar, phosphate and nitrogenous base. Sugar is…

Q: Which of the following DNA double helices would be more difficultto separate into single-stranded…

A: DNA/ RNA is made up of bases purines and pyrimidines apart from phosphate and sugar. Chargaff's rule…

Q: given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the…

A: Introduction The DNA helix acts as a template for its own duplication. Because the nucleotide A will…

Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…

A: DNA probes are single-stranded DNA segments that are hybridised to indicate the existence of…

Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…

Q: Give the DNA compliment to the following DNA strand. GAA CTT a b. GAA CUU BRB

Q: Which of the following DNA has a high G-C content? (Tm refers to the melting temperature of the DNA.…

A: In double stranded DNA the adenine binds with thymine and guanine binds with cytosine. This four…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…

Q: Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it…

A: A heritable genetic change in the genetic material of an organism that gives rise to alternate…

Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…

A: Complementary strands are two chains of DNA that make up the double-helical structure of DNA. The…

Q: Consider the following DNA molecule: ACG GTACACTTAC GA A T GCCAT G T GA A TG CTT 1) Draw the 2…

A: DNA stands for deoxyribonucleic acid. It is a nucleic acid, a polymer of nucleotides. A nucleotide…

Q: A strand of DNA has the sequence 5'-AGTC-3'. What is the sequence of the complementary strand in the…

A: The DNA has two strands which are comprised of nucleotides- A stands for adenine, T stands for the…

Q: true or false Primary amines and keto groups of the nitrogen bases are involved in base-pairing in…

A: The nucleic acids are biopolymers made of nucleotides. The nucleotides are joined together by…

Q: Which of the following DNA strands (oligonucleotides) would have a higher melting temperature?…

A: DNA is a double helical molecule which is found in the cells of living organisms. The two strands…

Q: A DNA antisense strand contains the following ucleotide base sequence CGA TIT GGT TGA 37. From thin,…

Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. C…

A: If we represent the nitrogen base as a triangle, there are going to be three edges: Hoogstein Edge:…

Q: Write the sequence of a strand of DNA replicated using each of the following base sequences as a…

A: DNA replication is a process in which a template strand of DNA is replicated by forming a new strand…

Q: If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?

A: A nucleotide is a bio molecule that consist of a nitrogenous base, a pentose sugar (deoxyribose in…

Question

Do question 13

Of the following DNA sequences which would you expect to have the highest melting
temperature in its double stranded form? For brevity, I have provided the top strand
only in the 5' to 3' orientation.
TCAGACAG
АТАСТАТС
GCGCATCA
GCATGATC
ATTTTACG

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

How many kilobases of the DNA strand below will code for the protein product?
State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
Using the straight-chain sugar convention where the vertical lines represent sugars and the diagonals are phosphodiester bonds, choose the correct structure of the DNADNA strand that encoded this short stretch of RNA. pppApCpUpGpGpCpApA−OH
If A represents 40% of the nucleotides in a particular piece of double stranded DNA, how often will the sequence GG appear? (You can say that GG would be expected to appear, on average, every _____ bases.) SHOW WORK!
How many possible nucleotide sequences are there for a stretch of DNA that is N nucleotides long, if it is (a) single- stranded or (b) double-stranded?