Answered: What is the melting temp. of the…

What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 6P: Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki...

See similar textbooks

Related questions

Q: Although glucose cannot be formed from acetyl-CoA, triglycerides can enter the glycolytic pathway…

A: Introduction Fats (or triglycerides) are ingested as food or synthesised by adipocytes or…

Q: & Compare and contrast the operation of 3-Part differential and 5-Part differential hematology…

A: Introduction The study of blood and blood diseases is known as haematology. Hematologists and…

Q: 1. Describe the three modes that prokaryotes can 'obtain' new genes. Be sure to identify…

A: Introduction Prokaryotes are organisms with cells that lack a nuclear envelop or have their genetic…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature formula : Tm = 4* (G+C) + 2 * (A+T) Number of G+C = 6 Number of A+T = 20

Q: between which two consecuative stages did fertilization occur

A: Fertilization is a cell-to-cell interaction mechanism that takes place among two unique cells: a…

Q: In 2008, malaria was the leading cause of death among children under five years of age in…

A: In 2008, nearly 90% of the total mortality due to malaria occured in African country.

Q: Which of these statements regarding the affected gene are likely to be TRUE? Both copies of the gene…

A: Rhabdomyosarcoma is a highly aggressive form of cancer, where mesenchymal cells become unable to…

Q: To explain: The adaptive radiation and describe the process by which it might arise.

A: Introduction According to the Evolutionary theory proposed by Darwin, every living organism changes…

Q: is one of the six largest oil exploration, natural gas, and petroleum companies in the ....world

A: The largest oil and gas production companies in the world are decided and calculated by the total…

Q: Innoor an A |RROTEL HERE........god ba

A: In this question we have to describe about the process of translution.

Q: What is the most important body organ in the body?

A: Introduction An organ is a collection of different tissues that can work together to perform a…

Q: Discuss the control of testicular function

A: The testes are two oval-shaped male reproductive glands that produce sperm and the hormone…

Q: Which of the following could affect the ability of an enzyme to catalyze a reaction? PH all of these…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Also you have posted graded questions…

Q: health implications on human, animals, and plants?

A: Health implications Health implications refer to any disturbances that have negative impacts on the…

Q: Explain why constructing a building with bricks, boars, and cement is analogous to an anabolic…

A: All metabolic changes occur in a series of events that follow a certain process known as the…

Q: Which of the following statements about action potentials and information transmission in the…

A: Introduction Action potential:- It is defined as a transitory, fast, sudden, and propagating change…

Q: Kindly provide 2 examples plants having "adaptations for climbing" including (i) mechanical…

A: Different adaptations helps the plants in growth and survival. There are several climbing…

Q: Papillary lines on the finger lines forming different directions. There are three main types of…

A: Human fingerprint patterns are clearly the most distinct biological property and may be used as a…

Q: What is a signal sequence, and what is it recognized by? In what cellular process do signal…

A: Signal peptide The N-terminus among most newly produced proteins that are headed for the secretory…

Q: Suppose a man who does not have Duchenne muscular dystrophy had a child with a woman who is a…

A: Duchenne muscular dystrophy is a type of genetic disorder, in which muscles starts to degenerate…

Q: Explain why each choice (a-d) is correct or incorrect. In order for an antigen to activate or…

A: ANSWER;- b)displayed on the surface of an APC along with MHC antigens Explain;-An…

Q: Female mammals undergo continuous reproductive cycles during their reproductive life. In the sense…

A: Introduction:- Although different species have different reproductive techniques, mammals in general…

Q: 2. Explain why one molecule of water has polar covalent bonds.

A: Water is polar because of its bent shape due to its molecule. As we know that water molecule is…

Q: What is thr role of kidney in the human body?

A: Introduction :- The kidneys are two bean-shaped organs located on either side of your spine, beneath…

Q: Air pollution and health implications on animals, plants and humans.

A: Introduction:- Chemicals or particles in the air that can impair the health of humans, animals, and…

Q: QUESTION 21 You sequence the XRAY gene with Sanger sequencing. A portion of the sequencing gel is…

A: The Sanger sequencing is used to determine the sequence of fragment of DNA. The gel electrophoresis…

Q: All but one of the following occurs during the inflammatory response. Select the example below that…

A: c. Vasoconstriction prevents excessive blood loss due to injury. It is the correct option.…

Q: Which of the following will cause local adjustments in an arteriole’s radius and hence vessel…

A: Cardiovascular system in the body consist of mainly three types of blood vessels which includes…

Q: Discuss four (4) evidence-based reasons why it is being highly proposed that we are under the…

A: Anthropocene Anthropocene epoch is the unofficial most recent epoch of the earth history where…

Q: An axon has a membrane capacitance of 4 x 10 F and the membrane resistance of 2 KQ. If the speed of…

A: Introduction The part of a nerve cell (neuron) that transports nerve impulses away from the cell…

Q: Are viruses living or dead? Discuss this question by applying your knowledge of viruses and their…

A: Introduction :- A virus is an infectious microorganism made up of a nucleic acid segment (DNA or…

Q: A group of organs having related structures or functions is known as a(n) Otissue organ group Oorgan…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: An autosomal trait that is expressed in both males and females but not in the same fashion (for…

A: A trait in an individual is mainly determined by genetics. But sometimes an allele can be influenced…

Q: b. Which of the following is not an important feature of schmooing? [Select]

A: Schmooing is an example of the sexual reproduction in the yeast by which the yeast produces sexually…

Q: The sequence below used the sequence in “1” and encountered a point mutation:…

A: According to Bartleby guidelines, we can only provide a solution for one question. Kindly repost the…

Q: 1. Polar Covalent Bonds a. Draw one water molecule. b. Indicate which bonds are polar covalent bonds…

A: Water is a polar molecule. It made up of 2 hydrogen atoms and 1 oxygen atom. Molecular formula…

Q: 3. Hydrogen Bonds a. Draw 4 additional water molecules (each with red polar covalent bonds) attached…

Q: How is the cell cortex regulatedlocally and globally to coordinate itsactivities at different places…

A: The cytoskeleton is an extensive structure that provides shape, strength, and motility to a cell.…

Q: 3. A recently discovered mutant yeast has a shorter glycolytic pathway, and with a new enzyme that…

A: Glycolysis process happens through several steps and during these steps, ATP molecules are produced.

Q: Which of the following is not a type of transfer of metabolites and other nutrients between and…

A: Nonvascular plants are plants that do not have any special internal pipelines or channels to carry…

Q: Recently, consumption of trans fatty acids has been linked to high blood cholesterol levels and…

A: Introduction Trans fats:- It is a type of unsaturated fat that naturally occurs in small amounts in…

Q: Luteinizing hormone (LH) and follicle stimulating hormone (FSH) are essential in female reproduction…

A: Introduction :- The pituitary gland, a tiny gland behind the brain, produces LH. LH is essential for…

Q: The movement of which two ions is responsible for maintaining the plateau phase of the action…

Q: Is glucose a polar or nonpolar molecule? How do you know?

A: Glucose is a set of carbohydrates that is a easy sugar with a chemical components C6H12O6. It is…

Q: Food: -Bread -Butter -Candy -egg white -Milk -Potato -Ripe banana -Unripe banan

A: To increase amino acid amount in diet should consume protein rich foods. Humam obtain nine…

Q: A substance required by humans in small quantities are

A: Introduction :- Humans are classified as Animalia in the biological kingdom (animals). Humans, in…

Q: Why is the mutation rate so muchhigher in mitochondria than in thenucleus (and chloroplasts)? Could…

A: The physical and functional unit of heredity is that the gene. They die knowledge from one…

Q: Vegetative propagation in liverworts is possible because of propagules known as gemmae. (True or…

A: Introduction Bryophytes is a proposed taxonomic division that includes the liverworts, hornworts,…

Q: 2. Girl-student had a cup of sweet tea with the cake after preceding 5-hour break in the food…

A: Introduction :- Carbohydrate metabolism refers to all of the biochemical processes that occur in…

Q: Give an example of a nucleoside analogue that has been used successfully as an antiretroviral drug.…

A: Nucleoside analogue can be defined as a class of drugs ,which are mainly used to as antiviral agent…

Question

What is the melting temp. of the following double-stranded DNA fragment

CATCGCGATCTGCAATTACGACGATAA

GTAGCGCTAGACGTTAATGCTGCTATT

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an â€œaverageâ€� human chromosome?
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?
DNA Structure Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCC
At 260 nm what component of DNA absorbs at this nm(hydrogen bond, phosphate backbone, nitrogenous base, deoxyribose).
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
true or false: Hydrophobic interactions between bases are the primary stabilizing forces responsible for maintaining the DNA double helix.