I need parts d, e and f solved please Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, whichhappens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS)after the promoter (in yellow) and proceeds in the direction of the arrow. Transcription stops atthe end of the Transcription Terminator sequence on the right (in blue).1.TSS5' -СТАТАAGAGCCATGCATTATCTAGATAGTAGGCTCTGAGAAТТТАТСТСАСТ-3'3'-GATATTTCTCGGTACGTAATAGATCTATCATCCGAGACTCTTAAATAGAGTGA-5'Which strand of DNA shown, the top or the bottom, is the template strand? Explain*briefly whya)b)Which strand of DNA shown, the top or the bottom, is the coding strand?c)Write the first 10 bases of the sequence of the mRNA produced from this gene? Labelthe 5' and 3' ends?If a mutation were found where additional five G/C (top/bottom) base pairs wereinserted immediately after the T/A base pair shown in bold in the DNA, what would bed)the effect on the size of the mutated mRNA?If a mutation were found where 5 base pairs were deleted immediately after the T/Abase pair shown in bold, in the DNA what would be the effect on the size of the mutatedMRNA?If a mutation were found where 5 base pairs were deleted upstream or before thetranscriptional start site, in the promoter region. What would be the effect on geneexpression? Explain briefly.f)

The mutation is a sudden and heritable change in the sequence of an organism's genome that gives…

Answered: If a mutation were found where…

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q.Where, approximately, will the transcription start site be?
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Mark the point at which transcription will terminate
Select the events from eukaryotic transcription from the list below and list them below in order, by letter, from earliest to latest during transcription. A. Sigma factor binds 5'TTGACA?' B. Rho separates DNA/RNA hybrid C. TFIID binds TATA Box D. RNA Pol Il binds E. Holoenzyme forms F. Template strand is used to synthesize a 5' to 3' polymer G. Transcript is moved into the cytoplasm H. U1, U2, U4, U5 and U6 sn RNPs bind transcript
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT Group of answer choices 1.The mutation would inhibit the promoter thereby inhibiting transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would move the promoter away from consensus and reduce the level of transcription 4.The mutation would bind the promoter to the consensus and produce normal levels of transcription
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? Q) Would there be an effect on translation of changing the fourthA in the template strand to a C? If so, what effect?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’- ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT 1.The mutation would move the promoter away from consensus and reduce the level of transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would bind the promoter to the consensus and produce normal levels of transcription 4.The mutation would inhibit the promoter thereby inhibiting transcription
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Shown below are three genes (gene 1, gene 2, and gene 3) located on the same bacterial chromosome. a) Indicate where on the diagram you would find the following for each gene: Promoter (p1 for gene 1, p2 for gene 2, and p3 for gene 3) Transcription termination site (tts1, tts2, and tts3) Start codon (start1, start2, and start3) Stop codon (stop1, stop2, and stop3) Template strand (ts1, ts2, and ts3), the DNA strand that directs RNA synthesis Be sure to indicate the component on the appropriate molecule (DNA or RNA).
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?

SEE MORE QUESTIONS

Recommended textbooks for you

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning