Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA…
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…
Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…
A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…
Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…
A: The sequence of protein is usually notated as a string of letters, according to the order of the…
Q: Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp…
A: Need to find the mature mRNA in above options
Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…
A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A:
Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…
A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…
A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…
Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…
A: The central dogma is referred as the central processing system which includes the transfer of…
Q: How is it possible that a given mRNA in a cell is found throughout the cytoplasm but the protein…
A: Introduction The main crucial elements of the genome are the genes which controls all the cellular…
Q: m
A: DNA → RNA RNA → protein
Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…
A:
Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…
A: BASIC INFORMATION GENETIC CODE These are the codes which helps in the formation of the protein…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…
A: DNA is the store house of genetic information. This information is in the form of nucleotide…
Q: Shown below is the sequence of the 5' end of a hypothetical mRNA. Where does translation of this…
A: Translation occurs when the mRNA gets attached to the ribosome and subunits and the initiation…
Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3
A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…
Q: Pick the most complete list of mRNA sequences that translate into Ser. Question 3 options:…
A: According to the question, we have to find out the option which is the most complete list of mRNA…
Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…
A: An open reading frame in molecular genetics describes the part of your reading frame that has the…
Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…
A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…
Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…
A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…
Q: NASA has identified a new microbe present on Mars and requests that you determine the genetic code…
A: Introduction RNA is an abbreviation for ribonucleic acid, a nucleic acid found in all living cells.…
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…
A: mRNA stands for messenger RNA( Ribonucleic acid). Protein translation is a process of making…
Q: . What mRNA base sequence would be obtained from the following portion of a gene?
A: Genetic information is transferred from genes to the proteins via messenger RNA.…
Q: How many bases would a mRNA have? if it was coded for a protein of 250 amino acids long? explain…
A: The flow of genetic information in a biological system is explained by central dogma and it involves…
Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…
A: The central dogma of life includes the following processes: Replication: In this process, the DNA…
Q: Translate the following mRNA into protein, starting from the first initiation codon:…
A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…
Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…
A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…
Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…
A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…
Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…
A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA
Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…
A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…
Q: The sequence of a segment of mRNA, beginning withthe initiation codon, is given here, along with the…
A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…
Q: What polypeptide sequences would you expect to result from a synthetic mRNA with the repeating…
A: The messenger RNA (mRNA) is a molecule produced during the process of transcription where the enzyme…
Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…
A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…
Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'
A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' As following the rules in Genetic code the…
Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…
A: Mature mRNA or mature transcript is the RNA present in eukaryotes which consists of exons with all…
Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…
Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…
A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…
A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…
Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…
A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…
Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the…
A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: Eukaryotic gene is defined as the DNA regions which will act as a template for the formation of RNA…
Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer.
- UUUUUU
- AAAAAA
- CCCCCC
- UAUAUA
- GAGAGA
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fiveA certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).Compare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural differences.
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?For each of the following mRNA sequences predict the appropriate protein sequence:a. AUGCGCCCCCAGUGACCACACb. AUGACAUGUGUAAACc. AUGAUAUCUAGACAAdraw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
- Given the following mRNA sequence, write the peptide sequence that will result from protein translation. Please indicate the correct directionality.The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read in the 5’ to 3’ direction from the mRNA sequence, which ones are STOP codons?
- For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.
