A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’

A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 6TYK

See similar textbooks

Similar questions

Describe step 6 of recombination: Resolution of the Holliday Junction
C. What is the purpose of the ethidum bromide that you add to the gel? Why do you need to be careful handling it? What type of light do you view the gel under if you use EtBr? D. What is the running buffer called that you submerge your gel in? E. What is the purpose of the molecular weight ladder? F. What are the 2 purposes of the DNA loading buffer?
Draw the structure of the double Holliday junctionthat would result from strand invasion by both ends of thebroken duplex into the intact homologous duplex shownin Figure Q5–3. Label the left end of each strand in the Hol-liday junction 5ʹ or 3ʹ so that the relationship to the paren-tal and recombinant duplexes is clear. Indicate how DNAsynthesis would be used to fill in any single-strand gaps inyour double Holliday junction.
In Noll’s experiment to test the beads-on-a-string model, exposure of nuclei to a low concentration of DNase I resulted ina. a single band of DNA with a size of approximately 200 bp.b. several bands of DNA in multiples of 200 bp.c. a single band of DNA with a size of 100 bp.d. several bands of DNA in multiples of 100 bp
. While studying the structure of a small gene that was recently sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains the following: 20 adenine (A) bases 30 cytosine (C) bases25 guanine (G) bases 22 thymine (T) bases How many of each base is found in the complete double-stranded molecule?
A diploid human cell contains approximately 6.4 billion base pairs of DNA. Q. How many nucleosomes are present in such a cell? (Assume that the linker DNA encompasses 40 bp.)
You are working in a biotechnology lab and are analyzing DNA. You obtain a sample of a short dodecamer of DNA that contains 12 base pairs. Assume the counterions present in your DNA solution are sodium ions. How many sodium ions must there be per dodecamer? Assume the 5′ end phosphates each bear a–1 charge.
Based on your understanding of homologous recombination answer the following questions.1. What enzyme is involved directly in Holliday junction formation? 2. What is the importance of the chi site in homologous recombination? 3. How Holliday junction is resolved specifically in bacteria? 4. What do you think this type of recombination occurs between bacteria andbacteriophage?
Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?
1. If the AaBBCc individual will be test-crossed, what is the probability that the resulting offspring will be heterozygous? a.three-fourth b.one-eighth c.one-sixteenth d.nine-sixteenth 2. Following Chargaff’s rule, what is the percent concentration of each nucleotide if the concentration of purine bases is 24%? a.A = 76%; G = 76%; C = 24%; T = 24% b.A = 38%; G = 38%; C = 12%; T = 12% c.A = 12%; G = 12%; C = 38%; T = 38% d.A = 24%; G = 24%; C = 76%; T = 76%
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
The enzymes BamH I and Bal II recognise different sequences but leave the same stickyends: BamH I: ----------G|G A T C C ------ Bal II: ----------A|G A T C T ------(i)Will the two enzymes result in the same number of fragments in a random DNAsequence? Give reasons.(ii)What’s the advantage of having such a pair of REs? Explain with example.