STR sites are the basis of the FBI Laboratory's Combined DNA Index System (CODIS). One STR site that is used inCODIS is TPOX, named for its location within an intron of the thyroid peroxidase gene located on human chromosome2. Different versions of the TPOX site are known, due to varying number of repeats of the short sequence "AATG". ForTPOX, the number of repeats found on different chromosomes varies from 6 to 13. Hence the "alleles" of this site arecalled "6", "7", "8", "9", "io", "11", "12" and "13".Any given individual can be homozygous for any one of these eight different alleles or heterozygous for two differentalleles of this set. The frequency of any given genotype, however, depends upon the individual frequency of each ofthese eight alleles in the population. For example, allele "6" occurs at a frequency of less than 5%, allele "11" at afrequency of 20% and allele 8" at a frequency of about 46%.See below for the double stranded DNA sequence of the *11" allele and a small amount of the surrounding sequence.TTAGGGAACC CTCACTGAAT GAATGAATGA ATGAATGAATААТСССТТGG GAGTGACTTA CTТАСТТАСТ ТАСТТАСТтTA1011GAATGAATGA ATGAATGAAT GTTTGGGCAA ATAAACGCTGCTTACTTACT TACTTACTTA CAAACCCGTT TATTTGCGAC(Note: This double-stranded DNA sequence is read like a book. Once you get to the right-side margin of your page yougo to the next line and continue reading.However double-stranded DNA is redundant for bio-informatics use. It takes twice as much memory and computingpower to work with. If you have one strand of the DNA, you can always predict the other. So the sequence above canalso be written in the default format. This is shown below as the top strand in a 5' to 3' direction without spaces:5'-TTAGGGAACCCTCACTGAATGAATGAATGААTGAATGAATGAАTGAATGAATGAATТGAATGTTTGGGCAAАТАAАСGCTG-3Re-type (or copy and paste) this single strand DNA format (including polarity) for the TPOX "11" allele into the "answerbox" below. Put the TPOX repeat units in bold* and confirm that there are 11 repeats of "AATG". Then explain in asentence or two which part of the DNA you drew is highly variable and which part is likely not to vary from person toperson.

DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or copy and paste) this single strand DNA format (including polarity) for the TPOX "11" allele into the "answer box" below. Put the TPOX repeat units in bold* and confirm that there are 11 repeats of "AATG". Then explain in a sentence or two which part of the DNA you drew is highly variable and which part is likely not to vary from person to person.

5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or copy and paste) this single strand DNA format (including polarity) for the TPOX "11" allele into the "answer box" below. Put the TPOX repeat units in bold* and confirm that there are 11 repeats of "AATG". Then explain in a sentence or two which part of the DNA you drew is highly variable and which part is likely not to vary from person to person.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

The D1S80 locus is located on human chromosome 1 and is characterized by a repeating 16 base pair (bp) sequence. Alleles for this locus vary depending on the number of repeats present, thus affecting the size of the locus. The D1S80 locus also contains two conserved sequences, a 32bp sequence at one end and a 113bp sequence at the other end. If the DNA of an individual is targeted for D1S80 amplification, and one of the resulting amplicons is approximately 785bp in size, how many repeats would be present in this D1S80 allele? The amplicon of interest is indicated by a red arrow in the diagram below.
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?
There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotides that are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation. Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE. Likewise, fill in the columns that contain a missense mutation with RED. Shade any columns that contain nonsense mutations with GREEN. Then Of the five mutations you identified in the mutant Mc1r gene, how many are: substitutions insertions deletions (Enter a number on each line.) 2. Of the five mutations…
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson–Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.
A new technique for rapidly determining the nuclesome structure for regions of chromatin is called Mnase-Seq. Briefly, in MNase-Seq experiments, the chromatin is digested with Micrococcal Nuclease (MNase) and then the resulting digest is subjecting to high throughput sequencing to identify sequences digested by enzyme. See this short article for complete explanation. In the experiment below, researchers conducted an Mnase Seq experiment on a region of a chromosome in the absence (OHT-) and presence (OHT+) of a Protein X. This protein has a dramatic effect on the expression of the Igll1 gene, but no effect on Top3b nor Vpreb1 genes. Based on this information, explain what Protein X is doing to influence the Igll1 gene (limit 4-5 sentences).
There may be more than one correct answer for each Which of the following motifs can be found in DNA-binding proteins? a.) helix-loop-helix b.) zinc fingers c.) leucine zippers d.) CpG islands Which of the following motifs can be used to bind protein dimers? a.) helix-loop-helix b.) zinc fingers c.) leucine zippers d.) CpG islands Which of the following are correct regarding enhancers? a.) Enhancers may be located a great distance from the initiation site they regulate. b.) Enhancers can be either upstream or downstream from the initiation site. c.) Enhancers directly bind DNA and prevent binding of activators to the DNA. d.) Enhancers may function in either orientation (forward or backward).
When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed position on the DNA, all the way around, usually in a clockwise manner. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?
Scientists have observed that individuals with LOW birthweight are MORE likely to become obese as teenagers. To study this observation in more depth, a scientist compared the methylation of the promoter region of the leptin gene in low birthweight (LBW) and normal birthweight (NBW) individuals by treating isolated DNA from these individuals with bisulfite and comparing the results to untreated DNA. The results are shown below. What conclusion can you draw? Untreated: ATTCGATTCGCGAA Treated NBW: ATTCGATTCGCGAA Treated LBW: ATTTGATTCGTGAA Scientists have observed that individuals with LOW birthweight are MORE likely to become obese as teenagers. To study this observation in more depth, a scientist compared the methylation of the promoter region of the leptin gene in low birthweight (LBW) and normal birthweight (NBW) individuals by treating isolated DNA from these individuals with bisulfite and comparing the results to untreated DNA. The results are shown below. What…