A piece of DNA 5.0 kb long is cloned and then cut out of the vector for analysis. This linear piece of DNA is digested with two restriction enzymes, EcoRI and BamHI, individually and in combination, and the resulting fragment sizes are determined by electrophoresis. The results are as follows: Enzyme name EcoRI ВатHI ECORI + BamHI Restriction fragment size | 4.5 kb; 0.5 kb 3.0 kb; 2.0 kb 2.5 kb; 2.0 kb; 0.5 kb Construct a potential restriction map based on these results.
Q: Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to…
A: Bg2(B) contians restriction site in between Pst1 and Kpn1. Given plasmid have one restriction site…
Q: If you design a set of primers for a PCR reaction, please describe the temperature that you will set…
A: PCR This is Polymerase Chain Reaction. This technique is used to amplify the specific sequences of…
Q: What bacteria were used for the isolation of the three enzymes (HindIII, NdeI and PvuI)? What type…
A: HindIII is isolated from Haemophilus influenzae . NdeI is an isolated from Neisseria…
Q: recombinant plasmid
A: DNA is the material that carries all the information about how a living thing will look and…
Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…
A: An enzyme that recognizes a specific sequence on the DNA strand and cuts the DNA into fragments is…
Q: EcoR1 is a restriction enzyme that cuts DNA at the following base sequence: 5' GAATTC 3' Which…
A: The restriction enzyme cuts the DNA at the specific recognition sequence.
Q: A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally,…
A: The restriction enzyme is a protein and it recognizes a specific sequence of short nucleotides and…
Q: What is the possible cause of the presence of an extra band in the results of DNA extraction and PCR…
A: This finding suggests that formation of multiple bands in non-denaturing gel electrophoresis is a…
Q: A circular plasmid of 10,000 base pairs (bp) is digested with two restriction enzymes, A and B, to…
A: in agarose gel electrophoresis we separate DNA bands based on their size.
Q: A linear piece of DNA that is 14 kb long is cut first by EcoRI alone, then by SmaI alone, and…
A: Restriction enzymes are the endonucleases that digest the DNA at specific sites called restriction…
Q: A 3000 bp circular DNA was treated with both HindIII and EcoRI restriction enzymes. EcoRI cuts at…
A: In this question, we are given two restriction enzymes EcoRI and HindIII with their restricting…
Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…
A: The corner stone of genetic engineering or recombinant DNA technology is a special class of enzymes…
Q: Assuming a circular piece of DNA (plasmid) was used as starting material, how many restriction sites…
A: Restriction enzymes are specific endonuclease that can cut a DNA at a particular sequence.…
Q: Which vectors can be used to clone a continuous fragment of DNA with the following lengths? a. 4 kb…
A: According to the question, we have to mention the name of the vectors that can be used to clone a…
Q: Construct a detail linear restriction map according to the given information in Table 1 below. Table…
A: Total size of DNA= 11 kb EcoRI has one restriction site cutting it into 2 fragments of 2kb and 9kb…
Q: Is it necessary to cut the isolated genomic DNA of an organism with restriction enzymes for…
A: Restriction enzymes are also known as DNA-cutting enzymes which recognizes one or a few target…
Q: When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA…
A: DNA is the genetic material present in all living cells. It carries information from one cell to…
Q: A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is…
A: If a molecule of double-stranded DNA which is 5 million base pairs long, has a base composition that…
Q: Can you please interpret and discuss and mark, this gel electrophoresis results. DNA ladder sizes:…
A: A molecular-weight/ size marker, also referred to as a DNA ladder, is a set of standards that are…
Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…
A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…
Q: Which restriction enzyme used in your simulated electrophoresis experiment produced DNA with ‘sticky…
A: Restriction Enzymes or "Restriction endonucleases" are proteins that cut DNA at a specific base…
Q: A purified piece of DNA of 1650bp is cut with Hind III and Pst I separately and then with both…
A: Restriction enzymes are endonucleases derived from bacteria that make a double-stranded cut in the…
Q: The figure below shows the recognition sequences and cleavage positions of three restriction…
A: Restriction enzymes are those that have a tendnecy to cut the strands of DNA straight. This leads to…
Q: If a uidA amplicon generateed by PCR is 200bp and the DNA fragments resulting from the restriction…
A: INTRODUCTION Polymerase Chain reaction This is the method of amplification of of nucleic acids such…
Q: tarting material, how many restriction sites were there considering you observed three bands after…
A: Restriction enzyme or restriction endonucleases act on certain specific sites present in the double…
Q: See the restriction enzyme map below. The total DNA length is 1800 base pairs. If this DNA is cut…
A: An enzyme derived from bacteria that cuts DNA molecules at specified sequences is known as a…
Q: You have a 100 micromolar stock solution of dNTPs in the freezer and are setting up a PCR reaction…
A: PCR is the polymerase chain reaction. In this exact amount of reagents to be added in order to…
Q: -gene--- 5'-GTCGACAAGCTTAAGCCTAAGCTTTAGCGAAGCTTGTCGAC-3' Recognition sites Sall 5'-GTCGAC-3'…
A: Sticky ends are short single-stranded overhanging segments of one DNA strand after the Double DNA is…
Q: What would be the final primer concentration if 0.5 μl of 10 μM primers were added to a PCR reaction…
A: In laboratory work, the volume and concentration plants an important role. Slight difference in…
Q: You are considering using restriction enzymes that recognizes 4-bp and 6-bp nucleotide sequences,…
A: From theory we know, the longer the restriction site recognized by a particular restriction…
Q: An 800 bp fragment is completely digested with a single restriction enzyme. Fragments of 50*, 150*,…
A: Restriction enzymes are those enzymes which recognize and cleave at a particular sequence. In this…
Q: Write the sequences of the two 12-residue primers that could be used to amplify the following DNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: The restricition EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3' the restriction…
A: The restriction enzymes cuts specific sequence on double stranded DNA molecule and they are used in…
Q: This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and…
A: The restriction endonucleases are also called molecular scissors as they cut the DNA fragments at…
Q: Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each…
A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…
Q: In the amplicon insert you have an enzyme restriction site for NdeI at 500 bp. If you digest the…
A: Answer: RESTRICTION ENZYME = These are the enzymes or molecular tools which are used to cut the…
Q: A 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6…
A: Restriction enzymes are also known as restriction endonucleases. These are the enzymes produced by…
Q: A 22-kb piece of DNA has the following restriction sites:A batch of this DNA is first fully digested…
A: The restriction enzymes clean the nucleotide fragment at specific sides called the restriction…
Q: Please answer both parts, a. The enzyme that catalyzes the joining of fragments to form recombinant…
A: The recombinant DNA technology is a branch of biology that deals with different techniques that…
Q: Restriction enzymes cut double-stranded DNA _____. a. at noncoding areas between genes b.…
A: Restriction enzymes cut double-stranded only at specific sequence of the dna, producing either a…
Q: If restriction endonucleases are produced by bacteria within a host, why don’t these enzymes chew up…
A: Introduction A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that…
Q: You are trying to clone a gene. You have successfully isolated it from the genomic DNA of an…
A: Gene cloning is a process to form multiple copies of desired DNA of interest. This is done to- * to…
Q: a) What are vectors? Describe extensively the roles vectors play in genetic engineering? Write short…
A: Note: Solving answer only for part A as per the guidelines, repost remaining part, please. The…
Q: You wish to amplify a segment of DNA from a plasmid template by PCR with the use of the following…
A: The process of gel electrophoresis is done after the PCR for the qualitative analysis of the PCR…
Q: To achieve a 10x depth coverage for a genome of length 10 Mbp, how many reads of 100 bp are…
A: A Coverage is multiplier based on total size of the genome. Formula = Coverage = (read length) x…
Q: The double stranded DNA sequence of a restriction enzyme cut site is typically complementary,…
A: Restriction enzymes are those enzymes which cut DNA by recognizing target sequences. Restriction…
Q: For the STR site diagramed below, each repeat unit, represented by a rectangle, is known to be 5 bp…
A: The length of the short tandem repeat (STR) is 5 bp. The PCR product contain 4 STR in the given…
Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the…
A: The correct option is b 5'CCATTGG3'. Sanger sequencing ( method of DNA sequencing and it involves…
Step by step
Solved in 2 steps with 2 images
- A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained.A 22-kb piece of DNA has the following restriction sites:A batch of this DNA is first fully digested by HpaI alone, then another batch is fully digested by HindIII alone, and finally, a third batch is fully digested by both HpaI and HindIII together. The fragments resulting from each of the three digestions are placed in separate wells of an agarose gel, separated by gel electrophoresis, and stained by ethidium bromide. Draw the bands as they would appear on the gel.The gene you are asked to clone is 30,000 bps in length. When you are choosing a suitable Restriction Endonuclease, what criteria about the enzyme can you deduce from the gene length?
- All of the following are performed during restriction fragment length polymorphism analysis. 1. splitting of double-stranded into single-stranded DNA 2. gel electrophoresis 3. autoradiography 4. immersion in radioactive probes 5. digestion of DNA with restriction endonucleases 6. use of a positive charge to transfer single-stranded DNA from a gel to a membrane. The correct sequence of these operations is whatWhich vectors can be used to clone a continuous fragment of DNA with the following lengths? a. 4 kb b. 20 kb c. 35 kb d. 100 kbAbove are the results of gel electrophoresis following digestion with restriction enzymes. What is the total length of the DNA fragment? Which enzyme, HindIII or EcoRI, produced a larger fragment? What part of DNA causes it to be negatively charged in order for electrophoresis to work?
- If you were to isolate genomic DNA from two people and perform restriction enzyme digestion followed by agarose gel electrophoresis, would this be an effective way to distinguish one person from the other? Explain. If not, what is another technique you might use to distinguish the two people?A purified piece of DNA of 1650bp is cut with Hind III and Pst I separately and then with both enzymes together. The following are the observations in gel electrophoresis (fragments sizes are in bp). HindIII 300 500 850 PstI 100 600 950 HindIII and PstI 100 250 300 400 600 Use this information and make a restriction map of DNA.A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bp
- When the restriction endonuclease EcoRI is used to digest a 10 kb DNA fragment, it produces 4 kb and 6 kb-sized fragments. Digesting the 10 kb fragment with BamHI yields three fragments, each ranging in size from one to three and a half kilobytes. Four pieces of 0.5, 1, 3 and 5.5 kb are formed after using both enzymes. Create a restriction map for this 10 kb piece of DNA using the information you have collected. Make a note of where the two enzymes cut, as well as the distances between the enzymes.In relation to the use of restriction enzymes in recombinant DNA technology, answer the following: You have accidentally torn the labels off two tubes (tube A and tube B), each containing a different plasmid, now you do not know which plasmid is in which tube. Fortunately, you have restriction maps for both plasmids, shown in Figure below. You have the opportunity to test just one sample from one of your tubes. By utilizing agarose gel electrophoresis technique, which restriction enzyme OR combination of restriction enzymes would you use in this experiment to determine which plasmid is found in which tube?. (Hint: if you use Hind III restriction enzyme you are going to get ONE single fragment with a molecular size of → 0.5+0.3+0.2+0.4+1+1 = 3.4 kb).You are performing an experiment using CRISPR-cas9 to genetically modify the LacZ gene of a culture of E. coli. After you run the experiment, you decide to use gel electrophoresis to genotype the different bacterial cultures to determine if the gene editing was successful. How could your electrophoresis results confirm that the PCR was successful? And how could your electrophoresis results confirm that you successfully extracted genomic DNA from your bacterial samples?