Enzyme Fragment Size (kb) EcoRI 1.3, 1.3 Hpall 2.6 HindIII 2.6 ЕcoRI + Hрall 1.3, 0.8, 0.5 EcoRI + HindIII 0.6, 0.7, 1.3 (a) Is the original molecule linear or circular? (b) Draw a map of restriction sites (showing distances between sites) that is consistent with the data given. (c) How many additional maps are compatible with the data? (d) What would have to be done to locate the cleavage sites unambiguously with respect to each other?

Enzyme Fragment Size (kb) EcoRI 1.3, 1.3 Hpall 2.6 HindIII 2.6 ЕcoRI + Hрall 1.3, 0.8, 0.5 EcoRI + HindIII 0.6, 0.7, 1.3 (a) Is the original molecule linear or circular? (b) Draw a map of restriction sites (showing distances between sites) that is consistent with the data given. (c) How many additional maps are compatible with the data? (d) What would have to be done to locate the cleavage sites unambiguously with respect to each other?

Name: A small DNA molecule was cleaved with several different restriction nu
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained. EnzymeFragment Size (kb)EcoRI1.3, 1.3Hpall2.6HindIII2.6ЕcoRI + Hрall

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 5P

See similar textbooks

Similar questions

For each individual on gel, determine if the individual is homozygous for presence of the Alu insertion (++), heterozygous (+-), homozygous for the absence of the Alu insertion (- -), or if the results are inconclusive (I) (explain in detail what leads to your determination of each individual on the gel and why). Explain what may have caused any unexpected bands (neither 850 nor 550) lack of bands.
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
How many restrictions sites are present in the EcoRI. Calculate the number of restriction sites for EcoRI in 12689000kb molecule
Note that the table provided shows a ligation using a molar ratio of 1:3 vector to insert. Write out the complete recipe for a 5:1 insert: vector ligation reaction, including the volumes of insert and vector you calculated above, and the volumes required for a 20 uL reaction: Ligase buffer Nuclease-free water T4 DNA ligase
6. Explain why both deoxyribonucleoside triphosphates (dNTPs) and dideoxynucleosidetriphosphates (ddNTPs) are used in a Sanger sequencing reaction, with the dNTPs in largeexcess over the ddNTPs.
Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of making a perfect protein of 100 residues.(b) Repeat for a 1000-residue protein.
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
For each individual on each gel, determine if the individual is homozygous for presence of the Alu insertion(++), heterozygous (+-), homozygous for the absence of the Alu insertion (-), or if the results are inconclusive (I) (explain what makes you decide your determination, in detail). Explain what may have caused any unexpected bands (neither 850 nor 550) or lack of bands.
B. With what components do you make LB broth? Why is LB used when growing bacterial expression cultures?
Using the pKa data in as shown and the Henderson-Hasselbalch equation,calculate the approximate net charge on each of the four common ribonucleoside 5′-monophosphates (rNMPs) at pH 3.8. If a mixture of these rNMPs was placed in an electrophoresis apparatus, as shown, draw four bands to predict the direction and relative migration rate of each.
. Seven E. coli mutants were isolated. The activity ofthe enzyme β-galactosidase produced by cells containing each mutation alone or in combination with othermutations was measured when the cells were grown inmedium with different carbon sources.Lactose +Glycerol Lactose GlucoseWild type 0 1000 10Mutant 1 0 10 10Mutant 2 0 10 10Mutant 3 0 0 0Mutant 4 0 0 0Mutant 5 1000 1000 10Mutant 6 1000 1000 10Mutant 7 0 1000 10F′ lac from mutant 0 1000 101/ mutant 3F′ lac from mutant 0 10 102/ mutant 3Mutants 3 + 7 0 1000 10Mutants 4 + 7 0 0 0Mutants 5 + 7 0 1000 10Mutants 6 + 7 1000 1000 10Assume that each of the seven mutations is one andonly one of the genetic lesions in the following list.Identify the type of alteration each mutation represents.a. superrepressorb. operator deletionc. nonsense (amber) suppressor tRNA gene (assumethat the suppressor tRNA is 100% efficient in suppressing amber mutations)d. defective CRP–cAMP binding sitee. nonsense (amber) mutation in the β-galactosidase genef.…