A protein uses a gene template in 3' to5' direction. What are the amino acidsequences following this DNA chain?5'-ATGTCGACAGCCTAA-3'FirstSecond LetterThirdLetterUAGLetterphenylalanineserinetyrosinecysteineUphenylalanineserinetyrosinecysteineUleucineserinestopstopAtryptophanargininearginineleucineserinestopleucineprolinehistidineUleucineprolinehistidineleucineprolineglutaminearginineAleucineprolineglutaminearginineGisoleucinethreonineasparagineserineUisoleucinethreonineasparagineserineAisoleucinethreoninelysinearginineAmethioninethreoninelysinearginineGvalinealanineaspartateglycineUvalinealanineaspartateglycineGvalinealanineglutamateglycineAvalinealanineglutamateglycineGO Met-lle-Thr-Ala-STOPO Met-Ser-Thr-Ala-STOPMet-Ser-Trp-Arg-STOPMet-Tyr-Thr-Arg-STOP

Name: A protein uses a gene template in 3' to5' direction. What are the ami
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A protein uses a gene template in 3' to5' direction. What are the amino acidsequences following this DNA chain?5'-ATGTCGACAGCCTAA-3'FirstSecond LetterThirdLetterUAGLetterphenylalanineserinetyrosinecysteineUphenylalanineserinetyrosinecysteineUleucine

The above given statement is about protein and amino acids and their codons.

Answered: A protein uses a gene template in 3' to…

Science

Biology

A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 1TYK: Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding daughter strand sequence? A. 3' - GGG - TAT - CTC - TTT - 5' B. 5' - GGG - TAT - CTC - TTT - 3' C. 3' - GGG - UAU - CUC - UUU - 5' D. 5' - GGG - UAU - CUC - UUU - 3'
What is the amino acid sequence of the peptide that would be synthesized after transcription and translation of the following piece of template strand DNA? 5' 3' codon translations _________________________ codon amino acid T C A T G C G C A A C A AGU Ser ACG Thr CGU Arg UGU Cys UGC Cys GCA Ala UGA stop
using the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence 5’-TAT-GGC-ATG-3’? Ile-Arg-Pro His-Ala-Ile Tyr-Gly-Met Val-Arg-Tyr Ile-Pro-Tyr
If the mRNA sequence is 5'-UUU-CCC-AAA-3'.The DNA coding strand should be 5'-TTT-CCC-AAA-3' ?The DNA template strand should be 3'-AAA-GGG-TTT-5' ?So in the 5 to 3 direction, the DNA template strand should be 5'TTT-GGG-AAA-3' ?
Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’ 5’-CAUCUG-3’ 3’-CUGCAU-5’ 5’-AUCGAC-3’ 3’-GACGUA-5’ Which tRNA strand is complementary to the first codon in the above mRNA strand? 3’-GAC-5’ 5’-AUG-3’ 3’-CAU-5’ 5’-CAU-3’ 3’-AUG-5’ Which of the following amino acids is coded for by the above tRNA molecule (in a typical eubacterial cell like E. coli)? methionine N-formylmethionine threonine phenylalanine tyrosine
Which DNA strand is complementary to this template strand: 5’-GACGCT-3’? A. 5’-AGCGTC-3’ 3’-AGCTAG-5’ 5’-GACGCT-3’ 3’-GATCGA-5’ 5’-UCGAUC-3’ Which mRNA strand is transcribed from the above template DNA strand (the original)? 5’-GAUCGA-3’ 3’-CUGCGA-5’ 5’-CUAGCU-3’ 3’-TCGATG-5’ 5’-AGUGUC-3’ Which tRNA anticodon is complementary to the first mRNA codon (above)? 5’-GAU-3’ 3’-UAC-5’ 5’-AGC-3’ 3’-CGU-5’ 5’-GCU-3’
How does one label the DNA-strands that look like this--------------------------------------------and mark the four ends with correct designations.The DNA-strand does contain a gene. In and around the gene sequence, mark the following areas with Exon Poly A tail addition signal Promoter Starcodon Introns Stop codon Does the gene from the drawing come from a pro- or a eukaryotic organism?
The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this gene code for? The top is the coding strand. 5' GGCTATGTATAGGGTAAACTTCTGACGCCTA 3' 3’ CCGATACATATCCCATTTGAAGACTGCGGAT 5’