How does one label the DNA-strands that look like this ---------------------- ---------------------- and mark the four ends with correct designations. The DNA-strand does contain a gene. In and around the gene sequence, mark the following areas with  Exon  Poly A tail addition signal  Promoter  Starcodon  Introns  Stop codon

How does one label the DNA-strands that look like this ---------------------- ---------------------- and mark the four ends with correct designations. The DNA-strand does contain a gene. In and around the gene sequence, mark the following areas with  Exon  Poly A tail addition signal  Promoter  Starcodon  Introns  Stop codon

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 10QP: What percentage of the DNA in the genome actually corresponds to genes? How much is actually...

See similar textbooks

Similar questions

What are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-T
If one DNA segment has the following base composition, 5'-CAGTTAGC-3', which of the following sequences is complementary? 5'-GCTAACTG-3' 5'-GTCAATCG-3' 5'-GCTAAGCT-3' 3'-GCTAACTG-5'
Reading from left to right, what is the nucleotide sequence on the other strand of DNA in this section? C-C-G-T-A-T-A-C-A-T* A. C-C-G-T-A-T-A-C-A-T B. T-A-C-A-T-A-T-G-C-C C. A-A-T-G-C-G-C-A-C-G D. G-G-C-A-T-A-T-G-T-A
What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…
Suppose the following base sequence was found in a segment of one strand of a DNA molecule: 3’ A-A-T-A-C-C-T-C-C-T-A-A-C-T 5’ What would be the bases in the complementary strand? Label the 3’ and the 5’ ends. Illustrate the DNA molecule below. Label the 3’ and the 5’ ends of both strands. Separate the above DNA molecule up to the seventh base. Add one primer for the leading strand complementary to the first base Adenine of the template strand. Add one primer for the lagging strand complementary to the seventh base Adenine of the template strand. Illustrate the DNA molecule. Label the 3’ and 5’ ends. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate the resulting DNA molecule. Label the 3’ and the 5’ ends of the template strands and the complementary strands. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate the resulting DNA molecule. Label the 3’ and the 5’…
The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
What is the polypeptide that will be formed from the following DNA sequence? Template DNA Sequence: 3' T A C T G C G T A G A C C T C 5'
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?
What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to the sequence 5′ T-A-T-G-C-A-G 3′ on the other strand?