A research team interested in mapping human genes discovered a new restriction length polymorphism (RFLP). The nature of the polymorphism is shown in the figure below: RESEARCH METHOD GAATTC СТТААG GAGTTC CTCAAG GAA TTC CT AAC GAGTTC CICAAG Long fragments Short fragments Туре 1 homozygote Туре 2 homozygote Heterozygote S a. They test the RFLP in a family with the pedigree below. The individuals colored blue affected by hemophelia, a blood clotting disease. Dad Mom daughter1 daughter2 son1 son1 On what chromosome is the RFLP found? Explain your answer.

Q: linkage disequilibrium

A: a) Linkage:  Linkage is the phenomenon of certain genes staying together during inheritance…

Q: A restriction enzyme with a 6 base pair recognition site will cut the human genome roughly a. 70…

A: A gene is the most fundamental unit of hereditary. A gene is made up of multiple nucleotide…

Q: People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA…

A: DNA (Deoxyribonucleic acid) from the affected individuals is studied to know the corresponding…

Q: 1.  (a) Restriction sites are usually ______.     Recombinant DNA Technology     Restriction…

A: Given, 1.  (a) Restriction sites are usually ______.     Recombinant DNA Technology…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…

A: The base composition of the genetic material is the same in all the species present on earth. The…

Q: The plasmid PSU922 is a circular DNA containing 25000 base pairs. The B-gal gene codes for the…

A: Restriction endonucleases, often known as restriction enzymes, are found in all prokaryotes. The…

Q: People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA…

A: Single nucleotide polymorphism (SNP) can be described as the change of a single nucleotide in a…

Q: Match Column A with Column B F. v Analysis of genome-wide patterns of gene expression F. v…

A: Recombinant DNA technology - It is a technology which forms the desired DNA sequence of interest by…

Q: Which of the following is an example of a recombinant DNA molecule? O a. a PCR-amplified…

A: Recombinant DNA technology : In this process two DNA molecules are attaches with each other for…

Q: Explain how the SNP changes the recognition sequence for the restriction enzyme and affects its…

A: *Single nucleotide polymorphisms (SNPs) involve variation of a single base pair and or SNPsbin the…

Q: In the accompanying diagram, the cate the positions of restriction sites in two alterna- tive DNA…

A: RFLP (Restriction Fragment Length Polymorphism) is a technique that exploits the variation in the…

Q: Sickle cell anaemia is caused by a mutation in the HBB gene. The normal wild-type βA allele contains…

A: Sickle cell anemia is a result of a mutation in the HBB gene. This gene contains the restriction…

Q: (RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNA sample…

A: Answer ::

Q: The detection of single nucleotide polymorphisms is possible with: O A. Restriction Enzymes O B. All…

A: SNPs or single nucleotide polymorphisms are the most common type of genetic variation in humans.…

Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…

A: Ans 1 :  Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…

Q: Human DNA and a particular plasmid both have sites that are cut by the restriction enzymes HindIII…

A: Answer- Restriction enzymes or molecular scissors cut the DNA into segments. It is highly specific…

Q: Which of the following approaches you can use to locate the relative positions of genes on…

A: Genes are located on chromosomes. These genes can not be targeted without using any specific gene…

Q: A researcher wants to cut this piece of linear DNA. 5'…

A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…

Q: Based on this AGE profile, which of the following statements is NOT TRUE? M Uncut Ndel Ndel (Pure)…

A: Electrophoresis is a method that uses an electric field to separate macromolecules in a fluid or gel…

Q: Match each word with the best description.…

A: As we know that Recombinant DNA technology is a set of techniques that enable the DNA from different…

Q: 1. a. What is PCR? Explain/relate its importance in DNA marker analysis. 1.b. What are restriction…

A: A restriction enzyme is a bacterial protein that cleaves DNA sequences at sequence-specific sites,…

Q: Which of the following statements about restriction fragment length polymorphism is FALSE? Select…

A: Restriction Fragment Length Polymorphism (RFLP) is a technique that allows species to be…

Q: You amplify the DNA sample shown with the indicated primers. Highlight in yellow the region that…

A:

Q: The figure below shows the recognition sequences and cleavage positions of three restriction…

A: Restriction enzymes are those that have a tendnecy to cut the strands of DNA straight. This leads to…

Q: A DNA fingerprint is based on _____. a repeating sequences found on noncoding regions b the…

A: DNA fingerprinting is commonly employed in investigations to connect evidence with suspects, but DNA…

Q: What are the sticky ends of the restriction fragments?   Select one: a. The surfaces of sticky ends…

A: In molecular biology , Restriction endonuclease are the enzymes that helps in splitting the DNA and…

Q: Another restriction enzyme is called HaellI. It cuts DNA at the following base sequence: CCGG GGCC…

A: restriction enzymes are those enzymes which helps in cutting dna at specific locations .

Q: genetic disease is caused by a deletion in part of a gene. The deletion results in one copy of the…

A: Option b

Q: The picture below depicts an aberration in the process of genetic coding. Which of the following…

A: DNA replication is the process by which a new DNA is synthesized by using a parental DNA molecule.…

Q: The following DNA sequence has been identified and named ‘Gene Z’. It is thought that this sequence…

A: PCR is a polymerase chain reaction, this is a biotechnological process which is used to amplify the…

Q: he sequences below indicated the 6bp recognition site for the restriction enzyme EcoRI. The lines…

A: EcoRI is a restriction endonuclease that is isolated from E. coli and is used in the gene cloning…

Q: The human gene for hemophilia is on the X chromosome. Below is a pedigree from a family afflicted…

A: Hi, Thanks For Your Question.  Answer : Correct Option Is b (20%) Explanation :  P (III-7 Is…

Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…

A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…

Q: The activity of restriction enzymes may produce fragments with sticky ends.  Sticky ends are   a) a…

A: Correct option is (c). Restriction enzyme, also called as restrictions endonucleases,  is a…

Q: You are studying a genome that has 42% G:C content and the remaining 58% of the genome is As and Ts.…

A: Restriction enzymes  The enzyme that is use to cut the DNA at specific site.

Q: Three mutations were obtained in a bacterial gene. An antibody is available for the protein product…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: The recognition site of some restriction enzymes are shown. Which will produce sticky ends?     A.…

A: Restriction enzymes also known as restriction endonucleases are the enzymes which acts on the…

Q: An individual is heterozygous for an allele. Allele A has a SNP that results in disruption of an…

A: Assume that the gene under consideration is called Gene1. Gene1 carries a restriction site for…

Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…

A: The guanine and adenine are purine bases. These are composed of 5 and 6 sided ring. Thymine and…

Q: If a mutation that alters EcoRI site 1 occurs in this piece of DNA, how will the banding pattern on…

A: The restriction enzyme is a protein that identifies a specific nucleotide sequence and cuts the DNA…

Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…

A:

Q: A linear DNA fragment was produced by digestion with the restriction enzyme, Xba1. This fragment…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: The recognition sites for the restriction enzymes BamHI, Xbal, and Bglll are G^GATCC, T^CTAGA, and…

A: Since it is the multiple choice question i will provide answer in next step.

Q: (i) For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: The sequence of 15 to 125 derived from the chromatogram is  AAATTGTTATC

Q: PCR

A: Polymerase chain reaction is known as PCR. PCR is a technique which is used to amplify or copy the…

Q: Examine the table of recognition sites for restriction enzymes below. Cutting with which two…

A: Restriction endonucleases are specific enzymes that recognize a specific DNA sequence (restriction…

Q: The sizes of the restriction fragments produced by cutting bacteriophage lambda DNA (48,502 bp) with…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.