Three mutations were obtained in a bacterial gene. An antibody is available for the protein product of this gene. Both Northern analysis (RNA separated by electrophoresis, blotted, and probed with DNA) and Western analysis (proteins separated by electrophoresis, blotted, and probed with antibodies) were performed on the mutants. The results are summarized below. Northem Size Western Size 1 2 3 1 2 3 Long Short Short Long For each mutation, what kind of mutation occurred and how do you know? a) Mutant 1 b) Mutant 2 c) Mutant 3

Three mutations were obtained in a bacterial gene. An antibody is available for the protein product of this gene. Both Northern analysis (RNA separated by electrophoresis, blotted, and probed with DNA) and Western analysis (proteins separated by electrophoresis, blotted, and probed with antibodies) were performed on the mutants. The results are summarized below. Northem Size Western Size 1 2 3 1 2 3 Long Short Short Long For each mutation, what kind of mutation occurred and how do you know? a) Mutant 1 b) Mutant 2 c) Mutant 3

Name: Three mutations were obtained in a bacterial gene. An antibody is ava
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Three mutations were obtained in a bacterial gene. An antibody is available for theprotein product of this gene. Both Northern analysis (RNA separated by electrophoresis,blotted, and probed with DNA) and Western analysis (proteins separated byelectr

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

A constitutive mutant is a strain that continuously makes aprotein that is inducible in the wild type. Describe two waysin which a change in a DNA molecule could lead to theemergence of a constitutive mutant. How could these twotypes of constitutive mutants be distinguished genetically?
Compared to the normal A allele, the disease-causing allele in sickle cell anemia (S allele) is missing an MstII restriction site. On a Southern blot of genomic DNA cut with MstII and hybridized with the probe shown on the diagram below, a person with sickle anemia, carrying two S alleles, will show Choose an answer below: a single band at 1.1 kb. a single band at 1.3 kb. a single band at 0.2 kb. one band at 0.2 and one at 1.3 kb. one band at 1.1 and one at 1.3 kb.
Genomic DNA from a family where sickle-cell disease is known to be hereditary, is digested with the restriction enzyme MstII and run in a Southern Blot. The blot is hybridised with two different 0.6 kb probes, both probes (indicated in red in the diagram below) are specific for the β-globin gene (indicated as grey arrow on the diagram below). The normal wild-type βA allele contains an MstII restriction site indicated with the asterisk (*) in the diagram below; in the mutated sickle-cell βS allele this restriction site has been lost. What size bands would you expect to see on the Southern blots using probe 1 and probe 2 for an individual with sickle cell disease (have 2 βS alleles)? Probe 1 Probe 2 (a) 0.6kb 0.6kb and 1.2kb (b) 0.6kb and 1.8kb 0.6kb, 1.2kb and 1.8kb (c) 1.2kb 0.6kb (d) 1.8kb 1.8kb a. (a) b. (b) c. (c) d. (d)
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
Researchers are manipulating the gene cxx2 for their experiments, and they have inserted a smallnumber of base pairs randomly somewhere into the gene. They isolate several versions (with differentinsertions) of this modified gene and carry out an RT-PCR using a primer that recognizes thetranscriptional start site area (eg. from +1 to +20), and a primer that binds to the polyA tail.For the first modified gene sample, they observe that the intron is no longer being spliced out.Which of the lettered arrowheads indicates a location where this insertion could be? (Therecould be one answer or several. Give all answers that apply)
Robert Bost and Richard Cribbs studied a strain of E. coli (araB14)that possessed a nonsense mutation in the structural gene that encodes Lribulokinase,an enzyme that allows the bacteria to metabolize the sugararabinose (R. Bost and R. Cribbs. 1969. Genetics 62:1–8). From thearaB14 strain, they isolated some bacteria that possessed mutations thatcaused them to revert back to the wild type. Genetic analysis of theserevertants showed that they possessed two different suppressormutations. One suppressor mutation (R1) was linked to the originalmutation in L-ribulokinase and probably occurred at the same locus. Byitself, this mutation allowed the production of L-ribulokinase, but theenzyme produced was not as effective in metabolizing arabinose as theenzyme encoded by the wild-type allele. The second suppressormutation (SuB) was not linked to the original mutation. In conjunctionwith the R1 mutation, SuB allowed the production of L-ribulokinase, butSuB by itself was not able to suppress the…
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions?1) Define the silent mutation in DNA? (2.5 marks)2) What is the codon usage bias? (2.5 marks)3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics? (10.0 marks)
A cystic-fibrosis mutation in a certain pedigree is due toa single nucleotide-pair change. This change destroys anEcoRI restriction site normally found in this position.How would you use this information in counseling members of this family about their likelihood of being carriers? State the precise experiments needed. Assume thatyou find that a woman in this family is a carrier, and ittranspires that she is married to an unrelated man whoalso is a heterozygote for cystic fibrosis, but, in his case, itis a different mutation in the same gene. How would youcounsel this couple about the risks of a child’s having cystic fibrosis?
Define and compare the following types of nucleotide substitutions. Which is likely to cause the most dramatic mutant effect? a. missense mutation b. nonsense mutation c. sense mutation
In the Avery, McLeod, McCarty Experiment where supernatant from heat killed, virulent S Strain pneumonia solutions were added to non-virulent R Strain pneumonia cell cultures and allowed to grow in liquid media (i.e., broth). In tubes where DNAase was added to the supernatant prior to cell culture, what was the observed effect when plating and growing the S. pneumonia cells to solid media? a All RNA was degraded and Transformation of the R Strain to S Strain occurred. b All Protein was degraded and Transformation of the R Strain to S Strain occurred. c All DNA was degraded and Transformation of the R Strain to S Strain did not occur. d All RNA was degraded and no Transformation occurred indicating RNA is the molecule of Transformation inheritance e None of the above are true
Robert Bost and Richard Cribbs studied a strain of E. coli (araB14) that possessed a nonsense mutation in the structural gene that encodes Lribulokinase, an enzyme that allows the bacteria to metabolize the sugar arabinose (R. Bost and R. Cribbs. 1969. Genetics 62:1–8). From the araB14 strain, they isolated some bacteria that possessed mutations that caused them to revert back to the wild type. Genetic analysis of these revertants showed that they possessed two different suppressor mutations. One suppressor mutation (R1) was linked to the original mutation in L-ribulokinase and probably occurred at the same locus. By itself, this mutation allowed the production of L-ribulokinase, but the enzyme produced was not as effective in metabolizing arabinose as the enzyme encoded by the wild-type allele. The second suppressor mutation (SuB) was not linked to the original mutation. In conjunction with the R1 mutation, SuB allowed the production of L-ribulokinase, but SuB by itself was not able…
Robert Bost and Richard Cribbs studied a strain of E. coli (araB14) that possessed a nonsense mutation in the structural gene that encodes Lribulokinase, an enzyme that allows the bacteria to metabolize the sugar arabinose (R. Bost and R. Cribbs. 1969. Genetics 62:1–8). From the araB14 strain, they isolated some bacteria that possessed mutations that caused them to revert back to the wild type. Genetic analysis of these revertants showed that they possessed two different suppressor mutations. One suppressor mutation (R1) was linked to the original mutation in L-ribulokinase and probably occurred at the same locus. By itself, this mutation allowed the production of L-ribulokinase, but the enzyme produced was not as effective in metabolizing arabinose as the enzyme encoded by the wild-type allele. The second suppressor mutation (SuB) was not linked to the original mutation. In conjunction with the R1 mutation, SuB allowed the production of L-ribulokinase, but SuB by itself was not able…