A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of eIF-2 alter translation? a. Initiation factors would not be able to bind to mRNA. b. The large ribosomal subunit would not be able to interact with mRNA transcripts. c. tRNAi-Met would not scan mRNA transcripts for the start codon. d. eIF-2 would not be able to interact with the small ribosomal subunit.

A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of eIF-2 alter translation? a. Initiation factors would not be able to bind to mRNA. b. The large ribosomal subunit would not be able to interact with mRNA transcripts. c. tRNAi-Met would not scan mRNA transcripts for the start codon. d. eIF-2 would not be able to interact with the small ribosomal subunit.

Name: A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of eIF-2 alter translation? a. Initiation factors would not be able to bind to mRNA. b. The large ribosomal subunit would not be able to interact with m

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 6RQ: A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA...

See similar textbooks

Similar questions

Which statement is true of the translocation phase of elongation during protein synthesis? a. The empty tRNA moves to the A site of the ribosomal complex. b. The empty tRNA moves to the T site of the ribosomal complex. c. The dipeptide moves from the A site to the P site of the ribosomal complex. d. The dipeptide moves from the P site to the A site of the ribosomal complex.
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
In Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?
Which statement regarding UTRs is TRUE? a) Transcription begins at the start of the 5' UTR b) Translation begins at the start of the 5' UTR c) The 5' and 3' UTRs are spliced from the mRNA transcript d) The translation stop codon is found downstream of the 3' UTR
Which sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c) AAATCTACTACGATT d) GGGTTGGGTTGGGTT
a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
Sickle cell anemia is a disease caused by a mutation at the genotypic level. A person with two copies of the gene has the disease, but a person with one copy of the gene does not have the disease. The diagram shows how this mutation affects an organism. Use the image to answer the question. Which conclusion can you draw based on the diagram? A. The mutation changed the amino acid sequence during the translation step. B. A mutation caused the information in DNA to change during the transcription step. C. A change in the DNA sequence can be carried over to the translation and transcription steps. D. The change that affected the translation and transcription steps does not affect the organism.
(a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?
The codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.
1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
With regard to transcriptional termination in eukaryotes, which model suggests that RNA polymerase is physically removed from the DNA? a. Allosteric model b. Torpedo model c. Both models d. Neither model
When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4 translation, however, is increased. A. Why? B. In general, what is the mechanism by which Gcn4 levels are increased? C. What would happen under high and low amino acid conditions if only one of the upstream ORFs were deleted from Gcn4? D. What would happen under high and low amino acid conditions if all of the upstream ORFs were deleted from Gcn4?