Below is an electron micrograph illustrating the process of simultaneous transcription and translation in a prokaryotic cell. Use this illustration to answer the question. A B Which of the following statements is correct? 1. The direction indicated by A, is the correct direction of RNA polymerase movement. 2. If C and D are both pointing to the first ribosome in the chain, then ribosome C is carrying a longer polypeptide chain. 3. If E is pointing to mRNA, then it is pointing to the 5'end of the mRNA. 4. If B is pointing to the DNA, then it is pointing to the 5' end of the DNA. O A. 1, 2 and 3 O B. 1 and 3 O C. 2 and 4 OD. 4 only O E. All of 1, 2, 3 and 4 are correct

Below is an electron micrograph illustrating the process of simultaneous transcription and translation in a prokaryotic cell. Use this illustration to answer the question. A B Which of the following statements is correct? 1. The direction indicated by A, is the correct direction of RNA polymerase movement. 2. If C and D are both pointing to the first ribosome in the chain, then ribosome C is carrying a longer polypeptide chain. 3. If E is pointing to mRNA, then it is pointing to the 5'end of the mRNA. 4. If B is pointing to the DNA, then it is pointing to the 5' end of the DNA. O A. 1, 2 and 3 O B. 1 and 3 O C. 2 and 4 OD. 4 only O E. All of 1, 2, 3 and 4 are correct

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SA: Put the following processes in order of their occurrence during expression of a eukaryotic gene: a....

See similar textbooks

Similar questions

Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:
Find the events from prokaryotic translation from the list below and list them below in order, by letter, from earliest to latest during translation A. Incoming tRNA occupies the A-site B. Small ribosome binds to Shine Dalgarno sequence C. 5’ methyl cap binds small ribosome D. Large ribosome subunit binds the small ribosome subunit E. P-site tRNA peptide is attached to the amino acid of the A-site tRNA. F. f-Met tRNA binds to P site G. Small ribosomal subunit binds mRNA H. Peptide released from complex.
Given: eukaryotic cells can make different proteins, using only one gene. How can a eukaryotic cell make different final proteins from the same gene? Note: some of the answers are actually correct statements, but they don't have anything to do with this question. A.Eukaryotes have 3 RNA polymerases instead of just one. B.Eukaryotes cannot perform simultaneous transcription and translation. C.Eukaryotes splice RNA and can do so in various arrangements. D.Eukaryotes lack the Shine Delgarno sequence.
Use the numbers below to indicate the correct order of events (from left to right) during the process of translation initiation in bacteria. large ribosomal subunit binds to the complex. IF3 is released. The small ribosomal subunit associated with IF1, IF2, and IF3 binds to the Shine-Dalgarno sequence on the mRNA. tRNA charged with f-methionine binds to the AUG codon at the P site. IF1 and IF2 are released, leaving the A site available for the second charged-tRNA to bind the codon at the A site. 3 1 5 4 2 2 1 4 5 3 1 3 5 2 4 3 4 2 1 5 4 2 1 3 5
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
Complete the following table: Type of RNA Functions Transfer RNA (tRNA) In a ribosome, plays a structural role;as a ribozyme, plays a catalytic role(catalyzes peptide bond formation) Primary transcript Small RNAs in the spliceosome
Pick either one of the following to answer: 1) Transcription and translation both involve an initiation, elongation, and termination phase. Describe how each of these phases occurs for both transcription and translation. OR 2) Both transcription and translation involve modifications following the termination step. Describe these modifications and the importance of each modification to complete the final product.
What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your own words, explain what this enzyme does.
Which of the following statements best describes the initiation of translation? A) The large and small ribosomal subunits scan the mRNA in the 3'–5' direction until the promoter is reached. B) A tRNA with the anticodon, AUG, enters the ribosomal complex and binds to the mRNA at the A site. C) The mRNA containing the start codon, AUG, sits at the P site and forms a complex with the corresponding tRNA, and the large and small ribosomal subunits. D) The mRNA attaches to the large ribosomal subunit and once the start codon reaches the A site, the tRNA binds and the small subunit completes the complex.
Can someone please draw a diagram to explain transcription and translation and difference in eukaryotes and prokaryotes listed
Use the Genetic Code below to help you answer the following questions. The nucleotide sequence of a hypothetical eukaryotic gene is: 3'- CCC CAT CAG TCA AGG GAA - 5' a. Provide the mRNA of the non-mutated gene. b. Provide the linear amino acid sequence of the non-mutated gene. üü c. Examine the mutated DNA sequence below. What would be the sequence of the mRNA? ü Mutated DNA sequence: 3' CCC CAC AGT CAA GGG AA 5' d. Provide the linear amino acid sequence of the mutated gene and identify the type of mutation. e. Comment on the consequences of this type of mutation?
Which of the following best describes the initiation of translation? A. The mRNA binds the large ribosomal subunit. The start codon is identified and an rRNA with methionine is bound to the start codon. B. The mRNA binds the small ribosomal subunit. The start codon is identified and the large subunit is recruited. C. The mRNA binds the small ribosomal subunit. The start codon is identified and a tRNA with methionine is bound to the start codon. D. The mRNA binds the small ribosomal subunit. The start codon is identified and the tRNA with methionine enters the A site.