Please type clear answer Use the pre-mRNA sequence shown below to answerthe following questions.MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'a. Underline the 5' and 3' splice sites, then write thesequence of the spliced mRNA in the space provided.b. Predict what would happen if the G in the 5' splicesite were mutated to a C.c. We learned in this topic that the 5' cap in an mRNAplays a role in translationis one plausible mechanism by which a 5' cap canenhance initiation ? How can you experimentallydemonstrate that a 5' cap is important for this processinitiation. What do you think?

The intron boundary (5' splice site) generally starts with GU sequence. The consensus sequence of 5'…

Answered: Use the pre-mRNA sequence shown below…

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 11TYU

See similar textbooks

Similar questions

Use the Genetic Code below to help you answer the following questions. The nucleotide sequence of a hypothetical eukaryotic gene is: 3'- CCC CAT CAG TCA AGG GAA - 5' a. Provide the mRNA of the non-mutated gene. b. Provide the linear amino acid sequence of the non-mutated gene. üü c. Examine the mutated DNA sequence below. What would be the sequence of the mRNA? ü Mutated DNA sequence: 3' CCC CAC AGT CAA GGG AA 5' d. Provide the linear amino acid sequence of the mutated gene and identify the type of mutation. e. Comment on the consequences of this type of mutation?
Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?
A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding sequence on the mRNA transcription? Group of answer choices A: TACACTGGTCAT B: ATGTGACCAGTA C: UACACUGGUCAU D: AUGUGACCAGUA None of the answers provided
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deleted
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
Give typing answer with explanation and conclusion Which description applies to alternative mRNA splicing? 1. heritable changes in gene expression that occur without altering the DNA sequence 2. processing of exons in mRNA that results in a single gene coding for multiple proteins 3. mRNA modifications such as additions of a 5′‑cap and 3′ poly‑A tail and removal of introns 4. a gene cluster controlled by a single promoter that transcribes to a single mRNA strand 5. protein modifications such as addition of a functional group or structural changes such as folding Answer 2 is correct.
a) Define the term gene expression b) State 4 difference between prokaryotes and eukaryotes gene expression c) state the importance of regulating gene expression
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequence
Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.

SEE MORE QUESTIONS

Recommended textbooks for you

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Human Biology (MindTap Course List)

Biology

ISBN:

9781305112100

Author:

Cecie Starr, Beverly McMillan

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS