A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which statement explains how the change in the DNA codon leads to this disorder? * The deletion mutation prevents the production of an important protein in the organism. O The insertion mutation caused the production of extra protein in the organism. O The substitution causes a different protein to be produced in the organism. OThe frameshift mutation stops the production of a protein in the organism.

Q: e? A)A gene's promoter sequence is transcribed into mRNA. B)Translation begins at the 5′ end of a…

A: Transcription is the process of formation of mRNA from the DNA.and Translation is the process of…

Q: the sequence of a DNA template is 17. What is the sequence of the mRNA that will result from the…

A: Transcription is the process by which RNA is synthesized with the help of DNA. Abrupt changes in the…

Q: A scientist isolates some mRNA from one gene and compares its sequence to that of the gene from…

A: a scientist isolates some mRNA from one gene and compares its sequence to that of the gene from…

Q: If a mutation deletes the start codon in a eukrayotic gene, which of the following most accurately…

A: The start codon is a three-nucleotide long sequence in a gene that is responsible for the initiation…

Q: A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which…

A: Mutation refers to the change in the sequence of nucleotides in a DNA molecule which acts as the…

Q: Use your DNA strand to construct a part of a messenger RNA molecule.            DNA            A G T…

A: When DNA is converted into mRNA then this process is called transcription.Transcription occurs in…

Q: The direction of MRNA molecule synthesis is . Select one: O a. From DNA strand that starts with 5' O…

A: BASIC INFORMATION TRANSCRIPTION  It is the process in which the genetic information present on one…

Q: Where in a gene would a 4-bp insertion mutation havethe least effect on gene expression?a. Intronsb.…

A: Mutation is defined as the change in genetic makeup triggered by natural or man made processes. The…

Q: How is a protein made in the cell? * O One strand of DNA in the ribosome combines with amino acids.…

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: Yes, all mutations change the resulting protein. No, the amino acid sequence has not been changed.…

A: Deoxyribonucleic acid (DNA) is the material that carries inheritable information to the succeeding…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: BASIC INFORMATION  TRANSLATION  It is the process in which protein is which formed from the…

Q: A promoter is ________.a. a specific sequence of DNA nucleotidesb. a specific sequence of RNA…

A: The correct answer is (a) a specific sequence of DNA nucleotides.

Q: Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C.…

A: Hello, thank you for your question, since you have not mentioned the DNA orientation I am answering…

Q: Cellular transcription is : O Use of DNA as a template to make complementary DNA O Use of DNA as a…

A: Transcription is the molecular process by which the DNA sequences are transcribed to the don…

Q: Which of the following is true about the genetic code?   A. A codon is three to six bases long.   B.…

A: The DNA (deoxyribonucleic acid) is the genetic material that is inherited from the parents by the…

Q: Which is the best definition of a genetic mutation? An error in a code. OA mistake during copying.…

A: A Mutation happens when a DNA gene is harmed or changed so as to adjust the hereditary message…

Q: Define the following terms: a. wobble hypothesis b. aminoacyl-tRNA synthetase c. tRNA d. AUG…

A: Wobble hypothesis was proposed by scientist Crick mainly to explain the observed degeneracy in the…

Q: Which of the following is true in regards to mutagenesis? Mutations occur because of a selective…

A: The process of altering genetic information of an organism through mutation is referred to as…

Q: Suppose that a gene has a mutation that changes one nucleotide. Compared to the protein produced…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Suppose that a mutation occurs in the middle of a large intron of a gene encoding a protein. What…

A: A gene is a stretch of nucleotides present in the DNA. It codes for the synthesis of an RNA or…

Q: A proteih was Which of the following mutations will least effect the protein's function? a) A…

A: If a point mutation does not produce any change in the the amino acid, it's called a SILENT…

Q: What is a gene? What does "base sequence" mean? If the base sequence of a segment of a molecule of…

A: Hello! Since you have posted multiple questions, we are answering only the first two questions.…

Q: Refer to the following illustration to answer the question. mobile genetic elements exon 1A…

A: Transposable genetic element are the DNA sequences which can shift their original locations and…

Q: DNA and RNA are both information carrying molecules that are essential to all forms of life today.…

A: Nucleic acids The two main types of nucleic acids are DNA and RNA. Both DNA and RNA are made from…

Q: Which of the following mutations likely has the MOST significant impact on the function of a…

A: Mutations are the changes in the nucleotide sequence which may result in the change of protein…

Q: If a scientist wants to target a DNA sequence in a gene that reads TAC CCG GGC TTA, what should the…

A: * DNA is composed of nucleotide bases . Four nucleotide bases are present  Adenine Guanine Thymine…

Q: Which of the following types of mutations would be predicted to harm an organism? explain your…

A: Introduction:- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: Addition or deletion of bases causes which kind of mutation? Select one: O a. Transversion O b. •…

A: Any heritable change that happens in the nucleotide sequence of the DNA is called a mutation.…

Q: Which of the following mutations would be most likely to havea harmful effect on an organism?(A) a…

A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…

Q: A biologist inserted a gene from a human liver cell into the DNA of a bacterium. The bacterium then…

A: It is majorly present within the nucleus. DNA can exist in different levels of complexity. Primary…

Q: ? 1. mRNA is formed with codons as product ons are translated and polypeptide chain is tr es into…

A: Genetic material- DNA and RNA acts as the genetic material in most of the organisms . DNA stands…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C   A  T  G Changes to A  T  C…

Q: What is true of all genes? OA. They use the same kinds of tRNA during protein synthesis. O B. They…

A: Genes are generally organized and packaged in components called chromosomes and genes are made up of…

Q: Which of the following is NOT an outcome of a point mutation? A) position effect B) no effect at…

A: It is the type of mutation where a single base is changed,  inserted or deleted from a DNA or RNA…

Q: The relationship between the gene and the synthesis of a specific protein: Describe the steps in the…

A: Answer:-  Relationship between gene and synthesis of specific protein:- there are many protein which…

Q: A protein was mutated at amino acid position 129. Which of the following mutations will least effect…

A: All amino acids share different properties.

Q: A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which…

A: Mutation Sudden heritable change in genetic material of an organism is called as mutation.…

Q: Translation is ___: O Use of RNA as a template to make proteins O Use of DNA as a template to make…

A: Nucleic acids are the polymers of nucleotides. DNA and RNA are the two main types of nucleic acids.…

Q: A protein was mutated at amino acid position 129. Which of the following mutations will least effect…

A: The correct answer for this question is option- (d) R mutated to D

Q: Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How…

A: A mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…

Q: This model represents protein synthesis since the TRNA is delivering amino acids to form a…

A: The two main steps involved in protein synthesis are: transcription and translation. These two…

Q: Mutations that affect organisms are those that involve exons. True or False

A: Mutation takes place when section of gene or exons are missing. The most common type of mutation…

Q: Such as in the case of sickle-cell disease, which of the following can occur from the mutation of…

A: Gene mutation is the change in expression of a gene which is caused by change in a single base pair…

Q: insertions

A: Any change in the DNA sequence of an organism is called a mutation. Mutation can be of different…

Q: Consider a protein that has all the 20 common amino acids in its primary sequence. Explain three…

A: A protein is a polymer of amino acids. Each amino acid is made up of a side chain, a carboxylic acid…

Intelligence

Intelligence refers to the intellectual functioning that compares a person's intelligence quotient (IQ) with other people of the same age. In other words, it is the ability to understand circumstances or situations and arrive at appropriate solutions. Both animals and plants exhibit intelligence.