the sequence of a DNA template is 17. What is the sequence of the mRNA that will result from the transcription of this sequence? 18. What would be the amino acid sequence that will result from the translation of the mRNA? 19. What would happen to the amino acid sequence if T replaces C as the 6th base in the template DNA? How would you classify this type of mutation based on the resulting polypeptide (silent/nonsense/missense)? 20. What would happen to the amino acid sequence if the 6th base of the original template DNA is deleted? How would you classify this type of mutation based on the resulting polypeptide (silent/nonsense/missense)? 3'-TACTTCAAACCGCGT-5'

the sequence of a DNA template is 17. What is the sequence of the mRNA that will result from the transcription of this sequence? 18. What would be the amino acid sequence that will result from the translation of the mRNA? 19. What would happen to the amino acid sequence if T replaces C as the 6th base in the template DNA? How would you classify this type of mutation based on the resulting polypeptide (silent/nonsense/missense)? 20. What would happen to the amino acid sequence if the 6th base of the original template DNA is deleted? How would you classify this type of mutation based on the resulting polypeptide (silent/nonsense/missense)? 3'-TACTTCAAACCGCGT-5'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was substituted with C (Question C) ? Question C: Guanine nucleotide (G shown in red in the DNA sequence below) was substituted by C Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:
Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…