A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which statement explains how the change in the DNA codon leads to this disorder? * O The frameshift mutation stops the production of a protein in the organism. O The substitution causes a different protein to be produced in the organism. The insertion mutation caused the production of extra protein in the organism. The deletion mutation prevents the production of an important protein in the organism.

A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which statement explains how the change in the DNA codon leads to this disorder? * O The frameshift mutation stops the production of a protein in the organism. O The substitution causes a different protein to be produced in the organism. The insertion mutation caused the production of extra protein in the organism. The deletion mutation prevents the production of an important protein in the organism.

Name: A thymine is changed to an adenine in one DNA codon which causes a pa
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: A thymine is changed to an adenine in one DNA codon which causes a particulardisorder. Which statement explains how the change in the DNA codon leads tothis disorder? *O The frameshift mutation stops the production of a protein in the organism.O The

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Similar questions

Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a. 3′-TATGCTAAT-5′ c. 3′-UAUCGUAAU-5′b. 3′-UTUGCUTTU-5′ d. 3′-CTCAGCTTC-5′
f the template strand of DNA has the sequence 5’-TCTAGGACT-3’, what will the sequence of the transcribed RNA be? A. 5’-AGAUCCUGA-3’ B. 5’-UCAGGAUCU-3’ C. 5’-AGUCCUAGA-3’ D. 5’-AGATCCTGA-3’ E. 5’-UCAGGATCT-3’
Scientific Inquiry Suppose you are a research assistant ina lab studying DNA-binding proteins. You have been giventhe amino acid sequences of all the proteins encoded bythe genome of a certain species and have been asked to findcandidate proteins that could bind DNA. What type of aminoacids would you expect to see in the DNA-binding regions ofsuch proteins? Explain your thinking
Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting amino acid sequence as a result of the mutation? What type of mutation occured? Hint: Determine the template, then first determine the amino acid sequence before the mutation, and then determine the amino acid sequence after the mutation. Show how you got your answer. 5' T-A-C-T-T-C-C-A-*G*-C-C-G-C-T-C 3'
If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA that is transcribed from this gene is: 5'AUGUAUGGUUGACUCCUAGCG3' Which strand of the DNA - top or bottom - is the template strand? Explain how you know.
Which rRNA plays a major role in the aligning of the transcript in the ribosome of prokaryotes? A. 28S rRNA B. 23S rRNA C. 16S rRNA D. 18S rRNA
Where in a gene would a 4-bp insertion mutation havethe least effect on gene expression?a. Intronsb. Exonsc. Regulatory regionsd. Introns and exons
A codon for leucine is UUA. A mutation causing a single-base substitution in a gene can change this codon in the transcribed mRNA into GUA (valine), AUA (isoleucine), CUA (leucine), UGA (stop), UAA (stop), UCA (serine), UUG (leucine), UUC (phenylalanine), or UUU (phenylalanine). According to the neutral theory of evolution, which of these mutations would you expect to be the most likely to be found within a natural population? Explain.
Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?
What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5' ACCTCATTGCTAC 3' 3' TGGAGTAACGATG 5'
Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’ 5’-CAUCUG-3’ 3’-CUGCAU-5’ 5’-AUCGAC-3’ 3’-GACGUA-5’ Which tRNA strand is complementary to the first codon in the above mRNA strand? 3’-GAC-5’ 5’-AUG-3’ 3’-CAU-5’ 5’-CAU-3’ 3’-AUG-5’ Which of the following amino acids is coded for by the above tRNA molecule (in a typical eubacterial cell like E. coli)? methionine N-formylmethionine threonine phenylalanine tyrosine
Process by which the DNA sequences encoding exons are exchanged and reordered through genetic recombination between DNA sequences encoding introns. Group of answer choices a)RNA editing b)Exon Definition c) Exon Shuffling d)Transesterification