A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5'-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC IGCCCCCATTTTAАСТТTСТTTAAТGAАTGCGGGCATATTTААТАСGCGCTATGCССАTCGTATGCGAT-3' 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3' to 5' direction? 3'- -5' 2) What are the first five ribonucleotides of the MRNA transcript of this gene ? 5'- 3) What are the first five ribonucleotides following exon 1 in the mature MRNA transcript? 5'- -3"
Please answer all parts of this question
"Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts for you. To get the remaining sub-part to be solved please repost the complete question and mention the sub-parts to be solved"
The part of a gene that codes for amino acids is called an exon. Most gene sequences in plants and animals' cells are broken up by one or more DNA sequences known as introns. Exons are parts of the gene sequence that are expressed in the protein, whereas introns are regions of the gene sequence that are not expressed in the protein and come between or interfere with the exons. Now, when RNA is first transcribed, it is a very, very long RNA molecule. The exons are the most crucial sections of the RNA. There are huge portions of RNA that get cut out.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps