(a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in proofreading and correcting synthesized DNA. RNA polymerase moves in a 5 to 3 direction in synthesizing mRNA. Ribosome moves in a 3 to 5 direction during translation. tRNA moves in a 3 to 5 direction during translation. (b) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation

(a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in proofreading and correcting synthesized DNA. RNA polymerase moves in a 5 to 3 direction in synthesizing mRNA. Ribosome moves in a 3 to 5 direction during translation. tRNA moves in a 3 to 5 direction during translation. (b) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
1. It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the removal of introns 2. This is a linkage between paired bases in the secondary DNA structure 3. It refers to the linkage between 2 nucleotides in the DNA molecule 4. Give the range of the number of nucleotides present in a single protein molecule 5. Identify the number of bases included in the nucleosome 6. It is an enzyme that cuts the bacterial plasmid at its cleavage site
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA?
. Which of the following statements best summarizes the differences between DNA and RNA? A) DNA is transcribed using RNA polymerase to form mRNA and mRNA is translated by the Ribosome to form a polypeptide, B) The bases in DNA contain sugars, whereas the bases in RNA do not contain sugar. C) DNA nucleotides contain a different glucose compared to RNA nucleotides. D) DNA is formed using the base uracil, whereas RNA uses the base thymine. E) DNA encodes the sequence of amino acids for the primary structure of a polypeptide whereas mRNA does not
The following DNA sequence is found on a chromosome in rice plants: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ What is the amino acid sequence of the longest protein that could be made from this stretch of DNA, assuming that this strand of DNA is the non-template strand? (Remember that the start of translation requires the sequence AUG in the mRNA and “STOP” is not an amino acid.)
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
Match the following with the correct nucleic acid. (mRNA, tRNA, rRNA, or All RNA) 1. This molecule is complementary to DNA. 2. This molecule is part of translation. 3. This molecule is part of the ribosome. 4. This molecule contains anticodons. 5. This molecule is esponsible for bringing amino acids to the ribosome. 6. DNA is used as a template to create this type of RNA molecule. 7. This molecule is part of transcription. 8. This molecule contains codons.
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation causes a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

SEE MORE TEXTBOOKS

GET THE APP

About FAQ Academic Integrity Sitemap Document Sitemap

Contact Bartleby Contact Research (Essays)High School Textbooks Literature Guides Concept Explainers by Subject Essay Help Mobile App

GET THE APP

Privacy

Your CA Privacy Rights

Your NV Privacy Rights

About Ads

Manage My Data

bartleby, a Learneo, Inc. business

		DNA polymerase moves in a 5 to 3 direction in proofreading and correcting synthesized DNA.
		RNA polymerase moves in a 5 to 3 direction in synthesizing mRNA.
		Ribosome moves in a 3 to 5 direction during translation.
		tRNA moves in a 3 to 5 direction during translation.

		missense mutation
		nonsense mutation
		silent mutation
		frameshift mutation