Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutation

The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Answered: Remember when looking up a codon make…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Question

Remember when looking up a codon make sure it is in its mRNA form.

Below is a sample of a segment of DNA…(copy from left to right)

3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’

5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’

What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids).

2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create?

3.What are three differences between a point mutation and deletion mutation

Expert Solution