а. The diagram shown below is a DNA replication bubble in E. co/i. A primer 5'-CCT-3' is synthesized to replicate this piece of DNA. 5' a GGAA (i) Will the primer anneal to the upper strand or the lower strand in the diagram? (ii) Draw the primer in a correct position in the diagram on the Answer Sheet and write the first five nucleotides to be added after the primer during elongation. Label the 5' and 3' ends. (iii) Would the strand that you have drawn in part (ii) be a leading strand or a lagging strand? In the diagram on the Answer Sheet, indicate ALL locations of heliease (by circle O) and the locations of gyrase/ topoisomerase (by arrow – (iv) +) if bidirectional replication occurs.

а. The diagram shown below is a DNA replication bubble in E. co/i. A primer 5'-CCT-3' is synthesized to replicate this piece of DNA. 5' a GGAA (i) Will the primer anneal to the upper strand or the lower strand in the diagram? (ii) Draw the primer in a correct position in the diagram on the Answer Sheet and write the first five nucleotides to be added after the primer during elongation. Label the 5' and 3' ends. (iii) Would the strand that you have drawn in part (ii) be a leading strand or a lagging strand? In the diagram on the Answer Sheet, indicate ALL locations of heliease (by circle O) and the locations of gyrase/ topoisomerase (by arrow – (iv) +) if bidirectional replication occurs.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 9P: Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram...

See similar textbooks

Similar questions

Draw the structure of the double Holliday junctionthat would result from strand invasion by both ends of thebroken duplex into the intact homologous duplex shownin Figure Q5–3. Label the left end of each strand in the Hol-liday junction 5ʹ or 3ʹ so that the relationship to the paren-tal and recombinant duplexes is clear. Indicate how DNAsynthesis would be used to fill in any single-strand gaps inyour double Holliday junction.
At a specific area of this chromosome, the sequence of nucleotides below is present where the chain opens to form a replication fork: 3’ C C T A A G C C A T T C G G A 5’ In cells replicating their DNA, the primase enzyme generates a primer from this template sequence, starting at the underlined A (A) of the template. What is the primer sequence (written 5'-->3')? Group of answer choices UCCGAAU ACCGAATCC ATTCGGA UGGCUUAGG UAAGCCU GGAUUCGGU
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.
Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?
In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the above
In Noll’s experiment to test the beads-on-a-string model, exposure of nuclei to a low concentration of DNase I resulted ina. a single band of DNA with a size of approximately 200 bp.b. several bands of DNA in multiples of 200 bp.c. a single band of DNA with a size of 100 bp.d. several bands of DNA in multiples of 100 bp
Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below. ...TACT... ...ATGA... Question 7 Select one or more: ...TAGT... ...ATCA... 1. ...TACT... ...ATGA... 2. ...TAAT... ...ATTA... 3. ...TAAT... ...AT_A... 4. ...TA_T... ...ATAA... 5. ...TATT... ...ATAA...
Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below. ...TACT... ...ATGA... Question 7 Select one or more: a) ...TAGT... ...ATCA... b) ...TACT... ...ATGA... c)...TAAT... ...ATTA... d) ...TAAT... ...AT_A... . e) ...TA_T... ...ATAA... f)...TATT... ...ATAA...
a) "Out of three E.coli DNA polymerases, DNA polymerases 3 has a high processivity and rate of polymerization and therefore better suited for replication of the genome" What is meant by processivity? how does the DNA polymerase 3 maintain high processivity? b) What is a replication fork ?. Give the protein/enzymes of a replication fork and describe their function?