Which enzyme activity of the glycogen debranching enzyme is operating during the release of glucose units linked to glycogen branchpoints via o1,6 glycosidic linkage? a. transferase activity b. phosphorylase activity c. phosphatase activity d. glucosidase activity
Q: How many molecules of Pyruvate can form from Glycerol metabolism as a by-product of fatty acid…
A: The major precursors of gluconeogenesis are lactate, glycerol, alanine, ketone bodies like…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: Predict the relative intensity and wavelength maxima for the given molecules and stated conditions.
A: Intrinsic fluorescence is observed due to three aromatic amino acid residues - phenylalanine,…
Q: Draw a simple diagram of ATP synthase, and insert it here. Indicate which parts are stationary and…
A: Introduction: Adenosine triphosphate (ATP) is the molecule of energy for cells, that drives many…
Q: (a) What is the function of helicase in DNA replication? (b) What is the function of DNA polymerase?…
A: DNA is called deoxyribonucleic acid. DNA act as genetic material in most organisms. DNA replication…
Q: 2. The following graph illustrate the binding of 02 to proteins: myoglobin and hemoglobin ( one…
A: Hemoglobin is an oligomeric conjugated protein with four peptide chains joined by a…
Q: Current research indicates that the cause of obesity is multifactorial. Briefly outline the roles of…
A: Obesity is a major health issue in developed countries, and it has become increasingly clear that…
Q: Explain the meaning behind the term "reducing sugar ".
A: Any sugar that acts as a reducing agent due to the presence of its free aldehyde or ketone…
Q: In an individual with chronic and excessive alcohol intake, gluconeogenesis is often not favored…
A: Gluconeogenesis is the process of synthesis of glucose molecules from non-carbohydrate sources such…
Q: During extended fasting (≥ 4 days), what is/are the purpose(s) of tissue protein breakdown? Circle…
A: Protein synthesis, other nitrogen-containing molecules, gluconeogenesis, and an energy source are…
Q: Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic…
A: Translation is the process where mRNA transcript of a particular gene is decoded to give rise to a…
Q: HN Histidine NH₂ OH HN + H |+ H-NH H
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Aside from Giemsa, what other stains could be used in staining blood for blood parasites? What is…
A: Giemsa staining method is widely uses for staining blood for blood parasites.
Q: Question 14 The hydrolysis of phosphoenolpyruvate proceeds with a AG" of about -62 kJ/mol. A major…
A: Phosphoenolpyruvate is an ester formed by combining the enols of pyruvate and phosphate. It comes in…
Q: What cofactor is formed when this reaction proceeds right during glycolysis? OPO,CH O OH 2-OPO,CH,…
A: Glycolysis is classified as one of the cytoplasmic pathways. The main role of this pathway is to…
Q: Cellulose cannot be digested and thus does not contribute to the caloric intake in humans. A) True…
A: Cellulose is an intricate organic compound found in large quantities in nature. It is a polymeric…
Q: A protein that has been reversibly denatured has Multiple Choice temporarily lost part or all of its…
A: Each protein has its own distinct sequence of amino acids, and the interactions between these amino…
Q: ased on the knowledge you gained from the cloning module, which of the lanes in the urs is…
A: Agarose gel electrophoresis is used to separate DNA molecules based on their size and analyze DNA…
Q: 1.Promoters usually contain an AT-rich sequence. How is this beneficial to transcription?
A: Promoter is a specific site upstream of a gene where RNA Polymerase binds and initiates the process…
Q: what are the structural features of protein
A: Protein is most important macromolecule and biomolecule. It is building block of body and providing…
Q: 1. A 185g plant based burger is composed 55% carbohydrates, 35% protein and 20% fat. Calculate the…
A: Total energy of a food is expressed in calories. A calorie is a unit of how much energy is in a…
Q: A patient is suspected of having low stomach acid, a condition known as hypochloridia. To determine…
A: The gastric sample here is acidic. The equation of titration of an acid (sample in this case) with…
Q: The phosphorylation of proteins is an important regulatory mechanism. a. Name three amino acids…
A: Phosphorylation of amino acids in protein is an important post-translational modification for…
Q: N-acetylglucosamine is a derivative of glucose and considered as ____________. a. non-reducing…
A: N- acetylglucosamine is a derivative of glucose. It is a monosaccharide which generally polymerize…
Q: Which of the following is least soluble in hexane?
A: Fatty acids (FA) are aliphatic chain with carboxylic acid group, which is non-polar molecule. This…
Q: When weighing the protein at the end of the activity, what major assumption is made about the…
A: Casein is a protein present in milk that contributes to the white colour of the milk. Cow's milk…
Q: In addition to cleaving peplides, chymotrypsin can akso catalyze the hydrołysis of certain small…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: Based on the given picture, answer numbers 1-3. Also, answer number 4. 1. What are the two…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, please repost…
Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'
A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…
Q: ACTIVITY 6.2.4 Give the systematic name of the following cyclic monosaccharides: 1. Name: OH Н OH Н…
A: Monosaccharides are carbohydrates with single sugar unit. The structure of monosaccharides can be…
Q: 5 Write equilibrium expressions for these reactions. (a) 2H,0,(g)=2H,0(g) + O,g) (b) 2N,0,(g)=…
A: Introduction: A number that relates the concentrations of the beginning compound and products of a…
Q: Write the basic concepts in metabolism
A: Cells are machinery structures which carry out various complex controlled biochemical reactions in…
Q: The synthesis of phosphocreatine is unfavorable. If dur- ing extended periods of rest, e.g.,…
A: Phosphocreatine (PCr) - It is a phosphorylated creatine molecule that works as transferable reserve…
Q: Based on the knowledge you gained from the cloning module, which of the bands in gure is associated…
A: A clone is a copy of a cell or organism that is genetically identical to the original. Clone…
Q: Q1. Many of the components for lipid synthesis need to be "activated", which happens by a variety of…
A: Lipids are non-polar biomolecules, which act as the major components of the plasma membrane, energy…
Q: Which of the following statements regarding enzymes and transition states is true? stabilization of…
A: Introduction: Catalysis is an important function of an enzyme. For any chemical reaction to occur,…
Q: a) Give the substrate for each of the following enzymes: (i) urease (ii) fructose oxidase (b)…
A: Introduction: Inhibitors are substances that go and bind to an enzyme and interfere with its…
Q: What is the purpose of adding the dishwashing liquid to the DNA extraction?
A: DNA extraction is a method of separating DNA from cell membranes, proteins, and other cellular…
Q: How do ADP and ATP regulate the glycolysis pathway?
A: Glycolysis is an important metabolic pathway which participates in the carbohydrate metabolism. This…
Q: 9. Which of the following changes would not affect a peptide GENSHIN? A. Heat B. Inorganic Salts C.…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: Interpret the two chromatograms below. Which of the two chromatograms will provide good sequencing…
A: In Automated DNA sequencing, using a laser the different fluorescent labelled nucleotides at the end…
Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…
A: Sickle cell anemia is a inherited disorders due to defect in the gene. In this disease mutation…
Q: Propose a mutation for Uniprotkb-P39086 and it’s effec
A: Mutations are the result of damage or alteration of a DNA gene such that the genetic message it…
Q: Discuss the uses of alpha-amylase, amyloglucosidase, debranching enzymes , proteases, beta-glucanase…
A: Enzymes are proteins made up of thousand different amino acid chains , catalyzes different…
Q: Increased protein metabolism leads to increase in which of the following? Select all that apply.…
A: Proteins are made up of amino acids. Protein metabolism involves the breakdown of proteins by…
Q: a. We have a molecule 2,3-bisphosphoglycerate (BPG), which is a negative allosteric modulator for…
A: 2,3-Bisphosphoglycerate is a molecule formed through the Rapaport-Lubering cycle. The…
Q: Compare and contrast proteoglycans, glycoproteins, and glycosaminoglycans. Cite examples for each
A: Glycobiology means the study of the structure, and function of carbohydrates attached to…
Q: body fat muscle proteins carbohydrates fiber glycogen Fasting decreases the intake of body breaks…
A: Answer Fasting decreases the intake of carbohydrates which is needed for energy. Without this the…
Q: Consider 3 molecules of galactose: (write only the whole number; no decimal places) a. How many…
A: Galactose is an aldohexose sugar. The galactose unit is found in the milk sugar known as lactose.…
Q: Which critical product/s of the light reaction are required for the Calvin cycle? О ATP O NADH O O O…
A: Photosynthesis is divided into light and dark reactions. In photosynthesis carbon dioxide is used to…
Which enzyme activity of the glycogen debranching enzyme is operating during the release of glucose units linked to glycogen branchpoints via o1,6 glycosidic linkage?
a. transferase activity
b. phosphorylase activity
c. phosphatase activity
d. glucosidase activity
Step by step
Solved in 2 steps
- a- Krebs cycle is the subsequent pathway of glycolysis. Although, pyruvate is the last product of glycolysis why the Krebs cycle does not initiate with pyruvate? b-Describe the roles of the NADH and FADH2 in glucose break down reactions.What might you expect if a mutation caused the ATP-allosteric site on phosphofructokinase to be permanently inactive? a. Less glucose transported into the cell. b. No effect on ATP production. c. Decreased ATP production d. Excessive ATP production.Oxidative phosphorylation is the process by which the free energy obtained from the oxidation of metabolic fuels is used to generate ATP. (a).Which enzyme reaction controls oxidative phosphorylation? (b).Describe the way this enzyme controls oxidative phosphorylation
- Which of the following enzymes is NOT required to glycogen synthesis? a. branching Enzymes b. UDP-glucose pyrophosphorylase c. glycogen synthase d. glycogen phosphorylaseThe effect of ATP on the allosteric enzyme PFK-1 is shown below. For a given concentration of fructose 6-phosphate, the PFK-1 activity increases with increasing concentrations of ATP, but a point is reached beyond which increasing the concentration of ATP inhibits the enzyme. (a) Explain how ATP can be both a substrate and an inhibitor of PFK-1. How is the enzyme regulated by ATP? (b) In what ways is glycolysis regulated by ATP levels? (c) The inhibition of PFK-1 by ATP is diminished when the ADP concentration is high, as shown in the illustration. How can this observation be explained? *A graph is included for this question*Amylo-1,6-glucosidase is called a. Glucantransferase b. Debranching enzyme c. Phosphorylase d. Branching enzyme
- How would a riboflavin deficiency affect the functioning of the citric acid cycle? Explain your answer.Statin drugs are used to treat hypercholesterolemia because they a. prevent cholesterol from inserting in plasma membranes b. prevent cholesterol ester formation c. inhibit HMG-CoA reductase d. stimulate HMG-CoA synthaseWhat would be the result of a lack of glucose 6-phosphatase activity?
- A7) Name the two enzymes that conduct substrate-level phosphorylation during glycolysisThe pentose phosphate pathway is an alternative pathway of glucose oxidation.(a). Give the two main products of this pathway.(b). Name the enzyme that controls this pathway. The deficiency of this enzyme is sometimes inherited from the parents. What do these patients suffer from?(c). How is this pathway related to nucleotide metabolism?Principal enzyme for the regulation of glycogenesis? a. phosphoglucomutase b. glycogen synthase c. glucose-6-phosphatase d. glycogen phosphorylase