a. The reading frame DNA sequence is b. The mRNA sequence is c. The polypeptide sequence is a.The mutated polypeptide sequence is b.What kind of mutation was produced? You obtained the sequence of the frog gene X you amplified in Question #16 through a process called automated sequencing. In automated sequencing, you are given aprintout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to dois to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space below.Primer DrarPOPBO mobComment 177DSMachine Cochie-144017Sigat C172N A 4 G 2 T2NNACTCA TCTGGTGGA TTC CTA TC CTG AC AG TG ATGIG CAAC TG G TAACTC TG AG GciGA TAAC CAG Ga CA AA AAGGTOTATAAG30TAARACA AAGCCTAACT TG GA AGAAGAGAGAAAAAGT TCA GTTTACACA TCT TTA TA TGA AGCAGA AG TC ca GA A ATCA TTA AAGATTTC TA TT TO TCA TTGAAATAAAa. The reading frame DNA sequence isb. The mRNA sequence isc. The polypeptide sequence isA disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When yousequence this mutated gene, you fınd that the last 'G' at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how thismutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of mutation was produced?The mutated polypeptide sequence isWhat kind of mutation was produced?

A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Answered: a. The reading frame DNA sequence is…

a. The reading frame DNA sequence is b. The mRNA sequence is c. The polypeptide sequence is a.The mutated polypeptide sequence is b.What kind of mutation was produced?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: What is the difference between molecular cloning and reproductive cloning?

A: Molecular cloning and reproductive cloning are two different techniques, which involves different…

Q: (right eye is represented on the right side while left eye is represented on the left s for all the…

A: In the above image visual pathway is shown. This is a pathway that carries visual information from…

Q: Identify the stages of the cell cycle for the highlighted cells

A: Cell cycle consists of G1, S, G2 and M phase.G1, S and G2 - consists of interphase stage. M phase is…

Q: You identify a new transcriptional regulator that binds a known sequence of DNA. You are able to…

A: Identify a new transcriptional regulator that binds a known sequence of DNA.Observe the behavior of…

Q: are control groups still used in today's medical research?

A: In clinical studies, the control group is crucial because they act as a benchmark for assessing the…

Q: The kcat and KM for chymotrypsin-catalysed cleavage of a synthetic substrate, S, were determined to…

A: An enzyme is a biocatalyst that increases the rate of a chemical reaction without changing the…

Q: Read Ch 21.3 and describe in at least 200 words what changes are necessary in human behavior to…

A: Biodiversity conservation is a pressing global concern due to human-induced threats like habitat…

Q: What is the probability of producing a child that will phenotypically resemble either one (one OR…

A: A genetic cross is an experimental breeding or mating between two individuals (typically plants or…

Q: Give typing answer with explanation and conclusion to all parts What would happen to the…

A: The process of protein synthesis is a vital cellular mechanism that involves transcription and…

Q: You have isolated DNA from a Three-toed tree sloth. As you increase the temperature of the DNA…

A: DNA (deoxyribonucleic acid) is a double-stranded molecule that carries genetic instructions for the…

Q: RD9 TBD1 0.99 M. canettii L4 L2 L3 L1 L7 b L5 Chimpanzee bacillus L6 M. pinnipedii M. mungi M.…

A: In the provided phylogenetic tree of Mycobacterium tuberculosis, the L5 and L6 lineages represent…

Q: 3. If combinatorial control was not used in a human genome, with a size of 3B bp, how many…

A: In this context, we explore the potential number of transcriptional binding sites, including…

Q: A molecule that changes an enzyme's conformation so that its active site elsewhere on the enzyme can…

A: Enzymes function as a catalyst that speeds up a chemical reaction. However, the enzymes themselves…

Q: What are extracellular vesicles (EVS)? Describe the 3 types of EVs. Describe the importance of…

A: Vesicles are membrane-bound sacs or compartments that exist within cells. They are formed by a…

Q: DNA is synthesized in the _____ to _____ direction. Question 20 options: 3', 5' 5', 3' 5…

A: DNA is de-oxy ribonucleic acid, which is a self-replicating material present in all living…

Q: Use this information to make dose curves to compare in the graphs below. Percent (%) of Seeds NOT…

A: A dose-response curve is a graphical representation of the relationship between the dose or…

Q: PART II. FOSSILS DIRECTIONS: Examine the illustrations of the marine organisms shown below whose…

A: Darwin proposed that fossil records provide evidence that living organisms evolved a million years…

Q: The results of the treatment of 20 boys with SCID-X1 showed that ____. a. the “treatment”…

A: Severe Combined Immunodeficiency (SCID) is a collection of uncommon genetic illnesses that impair…

Q: With respect to nerve impulses, the Rising Phase is initiated by binding of neurotransmitters to…

A: A nerve impulse is the transmission of electrical signal through the neuron cell. It occurs due to…

Q: 2. (a) In your notebook, sketch the phylogenetic tree in Figure 7, above. Do not include the…

A: A phylogenetic tree is a visual representation of the evolutionary associations between a few…

Q: From: Name this tissue: Anonymous Quiz 19% A. transitional epithelium X 28% B. stratified cuboidal…

A: Epithelial tissue is the covering tissue. It forms the outer covering of the body organs and…

Q: Identify the stage of the cell cycle for the highlighted cell

A: The picture is of fish embryo and it shows one of the stages of cell division. Cell division can be…

Q: Origins of viruses. Exactly how and when did different groups of viruses originate?

A: Viruses are small infectious agents that can replicate only inside the living cells of organisms.…

Q: (1) Why the ratio of PE/GFP fluorescence is measured in the FACS experiment, instead of measuring…

A: A G protein-coupled receptor (GPCR) helps control how much energy we have. The hormone called MC4R…

Q: The three fundamental classes of proteins involved in transport across membranes are: i) channels…

A: The three classes of proteins through which transport of ions or any substance takes place in the…

Q: 17, the Cp gene in Creeper fowl is responsible for slowing down growth at 36h of incubation,…

A: Understanding the significance of the Cp gene in this process might shed light on the mechanisms…

Q: Examine carefully the pedigree below to answer the question. I II III Number the offspring in each…

A: The pedigree analysis is a way of representing the genotypes of an individual and its entire family.…

Q: Biology using Michael Sandel's "Designer Babies," David Duncan's "DNA as Destiny" and Francis…

A: The complicated intuition between genetic engineering, biotechnology, and the thought of identity is…

Q: Betsy and Boopsie are half sisters (same mom, different dad). Boopsie has a son named Bobby. The…

Q: Your blood type is based on antigens found on your red blood cells named A or B and antibodies found…

A: Agglutination or clumping involves the antigen antibody reaction which occurs when antigen is mixed…

Q: Which of the following statements best describes the outcome of a mutation? a. A mutation always…

A: A mutation is a modification in a tiny part of a genome's nucleotide sequence. The notion of…

Q: The Minnesota Starvation Study led to many observations on the physiologic response to starvation.…

A: Between November 19, 1944, and December 20, 1945, the University of Minnesota conducted a clinical…

Q: Describe the process of neural toon in a vertebrate. How does it happen? How do the brain and spinal…

A: In this discussion, we investigate the method of neural development in vertebrates. This complicated…

Q: Draw a similar graph to show how glucose concentration changes in an OGTT from an individual with…

A: In the graph for an individual with diabetes, the glucose concentration will likely rise to a higher…

Q: 1. The image above (i.e., Figure A in the supplemental file) depicts which type of evolutionary…

A: Cladogenesis and anagenesis are two essential evolutionary biology processes that play critical…

Q: Tryptophan binds TrpR. True O False

A: Gene expression is the process by which information encoded in a gene is used to synthesize a…

Q: dried to produce a pellet. The pellet was re-dissolved in 15 mM Tris-HC1buffer, pH 7.3, centrifuged…

A: These are defined as glycoproteins. They have the ability to make bonds with carbohydrates like…

Q: Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and…

A: This is sequence alignment which can be done by putting each fragment in such a way that it may…

Q: The two populations are found in very similar environments (e.g., similar resources, same…

A: Genetic variation is the difference in DNA found in individuals or populations of the same species.…

Q: How does dead time affect diagnostic systems in nuclear medicine? how does it affect the patient?

A: The question explores the effects of dead time on diagnostic systems in nuclear medicine and its…

Q: You have isolated a true-breeding fish strain that has blue scales. Then you isolate another true-…

A: Epistasis is a phenomenon that consists of the effect of one gene being dependent on the presence of…

Q: In incomplete dominance inheritance, a snapdragon plant that is homozygous for red flowers is…

A: Incomplete dominance is a type of inheritance pattern in genetics where the heterozygous phenotype…

Q: Identify the stages of the cell cycle for the highlighted cells

A: Cell cycle is the mechanism through which a cell divides.It consists of- G1, G2, S and M phase. And…

Q: Use pictures to show major differences in macromolecular structural analysis using crystallography…

A: Various methodologies are used to determine the three-dimensional structure of a protein. Such…

Q: 5' 3' O Top strand 5' O Bottom strand Primer 1 ORF Primer 2 5' 3' You have designed primers to…

A: In DNA, the two strands are antiparallel, meaning they run in opposite directions. The top strand…

Q: What is the purpose of a Punnett Square

A: A Punnett Square is a graphical tool used in genetics to predict the potential genotypes of…

Q: The life table below is for a species of lizard. Use it to answer the questions below. It can be…

A: Population growth is the increase in the number of individuals within a specific area over a given…

Q: What are two examples for which HCPCS codes should be reported?

A: Healthcare Common Procedure Coding System is abbreviated as HCPCS. It is an internationally accepted…

Q: What is the action level of Naphthalene for marine aquatic organisms in Canada? What guidelines…

A: Naphthalene is a chemical compound found in various sources, including certain industrial processes,…

Q: genotypic frequencies at the glucose-6-phosphate isomerase (GPI) locus in the water flea. They…

A: Q 1.) :- Answer.To calculate the allelic frequency of the S2 variant within this population, we…

Question

a. The reading frame DNA sequence is

b. The mRNA sequence is

c. The polypeptide sequence is

a.The mutated polypeptide sequence is

b.What kind of mutation was produced?

You obtained the sequence of the frog gene X you amplified in Question #16 through a process called automated sequencing. In automated sequencing, you are given a
printout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do
is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space below.
Primer DrarPOPBO mob
Comment 177DS
Machine Cochie-144017
Sigat C172N A 4 G 2 T2
NNACTCA TCTGGTGGA TTC CTA TC CTG AC AG TG ATGIG CAAC TG G TAACTC TG AG GciGA TAAC CAG Ga CA AA AAGGTOTATAAG
30
TAARACA AAGCCTAACT TG GA AGAAGAGAGAAAAAGT TCA GTTTACACA TCT TTA TA TGA AGCAGA AG TC ca GA A ATCA TTA AAGAT
TTC TA T
T TO TCA T
TGAAATAAA
a. The reading frame DNA sequence is
b. The mRNA sequence is
c. The polypeptide sequence is
A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you
sequence this mutated gene, you fınd that the last 'G' at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this
mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of mutation was produced?
The mutated polypeptide sequence is
What kind of mutation was produced?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Determine Reading Frame Sequence

VIEW

Step 3: Find the mRNA sequence

VIEW

Step 4: Find the polypeptide sequence

VIEW

Step 5: Find the mutated DNA sequence

VIEW

Step 6: Find the kind of mutation

VIEW

Solution

VIEW

Step by step

Solved in 7 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

You obtained the sequence of the frog gene X you amplified in Question #16 through a process called automated sequencing. In automated sequencing, you are given a printout of the sense strand of your DNA. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. a.The reading frame DNA sequence is: b.The mRNA sequence is: c.The polypeptide sequence is: A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you sequence this mutated gene, you find that the last ‘G’ at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of…
You obtained the sequence of the frog gene X you amplified in Question #16 through a process called automated sequencing. In automated sequencing, you are given a printout of the sense strand of your DNA. T he printout is shown below. ' The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. The reading frame DNA sequence is: The mRNA sequence is: The polypeptide sequence is: A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you sequence this mutated gene, you find that the last ‘G’ at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the…
In automated sequencing, you are given a printout of the sense strand of your DNA. the first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space below. a. The reading frame DNA sequence is?
In automated sequencing, you are given a printout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space below. The mRNA sequence is:
In automated sequencing, you are given a printout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space The polypeptide sequence is:
If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not? Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?
Researchers are manipulating the gene cxx2 for their experiments, and they have inserted a smallnumber of base pairs randomly somewhere into the gene. They isolate several versions (with differentinsertions) of this modified gene and carry out an RT-PCR using a primer that recognizes thetranscriptional start site area (eg. from +1 to +20), and a primer that binds to the polyA tail.For the second modified gene sample, they observe that the mature mRNA is now several basepairs longer, however splicing has not been affected. They examine the protein and identify thatit has significant changes to its amino acid sequence, altering its length. Which of the letteredarrowheads indicates the location where this insertion could be? (There could be one answer orseveral. Give all answers that apply)
You sequence a gene of interest and isolate the matching mRNA. You find that the mRNA is considerably shorter than the DNA sequence. Why is that?
You isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
As we described in class, in the early 1960's Francis Crick and colleagues set out to determine how many nucleotide bases make up a codon, before it was possible to sequence DNA and before Nirenberg and his colleagues solved the genetic code. To do this, they used a chemical mutagen that they knew made single nucleotide changes, used this mutagen to conduct a screen for mutations that disrupted a particular gene, and collected a number of different mutations in this gene. Briefly describe the logic they used to deduce that the codon length is 3 nucleotides long.
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?