If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not?Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not? Human pancreatic y cellBacteriumGenomic DNAGenomic DNAPlasmid DNANucleusInsulin MRNAOther mRNASExtract and purify MRNA from cellsConvert mRNA to CDNAIsolate plasmid DNACut plasmid with restriction enzymesAmplify the insulin CDNA by PCRCut insulin CDNA with restriction enzymesLigate insulin CDNA and plasmidIntroduce recombinant plasmid DNA into bacteriaGrow large amounts of human insulin-expressing bacteriaRecombinant bacteriumInsulin proteinExtract and purify recombinant human insulin from bacteriaTHheleFigure 10-1Introduction to Genetic Analysis, Twelfth EditionO 2020 W. H. Freeman and Company

It is possible to chemically synthesise a gene in the lab by laboriously joining nucleotides…

If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not?

If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Choose correct option and do explain plz. 1. The protein complex that helps RNA polymerase to cross nucleosomes during extension is:a. SWI-SNFb. poly A polymerasac. TFIISd. FACT 2. The polydenylation is carried out by:a. primaseb. polymers poly ac. a reverse transcriptased. adenylyltransferase 3. The lactose operon produces a polycistronic mRNA that includes four genes: Lacl, LacZ, LacY and LacA. True or false?
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
You isolated a 10,500 base pair plasmid (supercoiled, cccDNA) from E. coli. The plasmid contains one unique recognition site for EcoRI, a restriction enzyme. Restriction enzymes recognize a specific sequence and cut both strands of the DNA at that sequence (Chapter 7). Brief DNase I treatment breaks one (or very few) phosphodiesterbonds in each DNA molecule, leaving the double-stranded DNA with one strand broken but the other strand intact, i.e “nicked.” You briefly incubated the cccDNA at 37°C in four separate reactions containing the components listed below. You ran each reaction sample on an agarose gel and visualized the DNA using ethidium bromide and UV light. The reactions included the appropriate buffer and ATP when required. An agarose gel containing four lanes of possible products is given below. Please refer to Figs. 4-26 and 4-27 in Watson for reference. For each reaction, indicate which lane of the gel contains the products that you would expect to see on your…
The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.
Plasmids are likely to contain: Question 55 options: Operons Antibiotic genes a promoter associated with each gene Restriction enzyme recognition sites human insulin gene
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Give typed full explanation you made a recombinant plasmid (it is circular) that contains the sequence 5' AAGCTT in the middle of the inserted or cloned gene. that is the only place where this sequence occurs. the entire plasmif does not have 5' GAATTC. When putting this plasmid into E. coli (transformstion) what will happen? 1. plasmid will cut into several fragments 2. nothing the plasmif with remain circular 3. plasmid will be cut once making a linear dna fragment 4. will be cut once but will becomr two linear fragments
Ultraviolet light causes thymine dimers to form in DNA. Some individuals are genetically incapable of repairing these dimers at "normal" rates. Such individuals are likely to suffer from _________________ due to a defect in their ___________________ DNA repair pathway. Severe Combined Immunodeficiency (SCID); DNA proofreading pancreatic cancer; base excision colon cancer; non-homologous end-joining muscular dystrophy; base-excision xeroderma pigmentosum; nucleotide excision
Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their sequence. Tip: The plasmid map is in Figure 3, details of restriction site sequences can be found at https://enzymefinder.neb.com/#!#nebheader
A linear DNA fragment and a plasmid has three restriction sites for EcoRIhow many fragments will be produced from linear DNA and plasmid respectively.
After transformation you were asked to grow bacterial cells transformed with plasmid on a plate that had X-gal and ampicillin. X-Gal is often used as in indicator dye, which turns blue when metabolized by B-galactosidase protein and used to test if cloning experiments have worked. [Note look at the vector diagrams carefully] Briefly explain how you would find the bacterial cells that are transformed with the plasmid with the YFG inserted.
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________