AAG a. What is indicated by label (2) in the figure above? b. What is indicated by label (3) in the figure above? c. What is the function of part (3)?
Q: What are the three domains of a growth factor receptor and what is the major purpose of each domain
A: Growth factor receptors may be composed of two subunits (heterodimers) and one subunit containing a…
Q: 35. What is the difference between a teratoma and an anaplastic tumor? A. Teratomas and anaplastic…
A: ▪︎Teratoma :Teratomas are germ cell tumors commonly composed of multiple cell types derived from one…
Q: 2. At the molecular level, what causes the absolute refractory period?
A: The period from the initiation of the action potential to immediately after the peak is known as…
Q: Explain the mechanism action of denaturation of protein from egg (Albumin) using isopropyl alcohol.
A: Denaturation involves the breaking of chemical bonds that support the protein in its highly ordered…
Q: 4. Identify the white structure indicated by tag # 4.
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Why is folic acid important during pregnancy?
A: During the early stages of pregnancy, intake of recommended quantities of folic acid helps to…
Q: 23. ID the region bracketing the letter 'A',
A: Question - 23 - ID the region bracketing the letter 'A'.
Q: Which are the two generalizations can be illustrated by CCK?
A: The digestive system in the human body is the one that consists of different organs which work…
Q: Describe the distinct SH domains and their binding specificities. How are SH domains in regulating…
A: * specific protein-protein interactions can be mediated by the binding peptides to small modular…
Q: 34. Explain the mechanism of action of tamoxifen in the treatment of breast cancer.
A: We know that Breast cancer develops as any of the cells in the breast tend to expand abnormally.…
Q: ibin
A: Prescribing the medications for treatment is the primary function of a doctor which has expanded to…
Q: Explain in short, two rieliable method of isolation of fatty acids from corn oil?
A: Fatty acids are one of the major components of oils produced from plants. such as corn oil. Fatty…
Q: 1.Would you expect a change in column temperature to have an effect on a reversed-phase…
A: A Physical method for the separation of compounds is called chromatography. In two…
Q: Explain the loss-of-function mutation ?
A: Mutation is a change in the sequence of genetic material naturally or by artificial factors. Such…
Q: Outline the steps of post-translational sorting of proteins tomitochondria.
A: Mitochondria are one of the most important organelles of a cell. These cells are essential to the…
Q: B-If a cell capable of de novo synthesis of purine-based nucleotides and has excess amounts of AMP…
A: GMP and AMP are synthesized from the precursor IMP. Aspartate reacts with IMP and forms…
Q: Utilizing Bentham's "Felicific Calculus" step-by-step, give a justification in practicing proper use…
A: The felicific calculus is an algorithm formulated by a philosopher named Jeremy Bentham for…
Q: 6. What effect does AP frequency have on NT release?
A: At chemical synapses, presynaptic action potentials activate voltage gated calcium channels,…
Q: What's possible source of error, if the creatinine concentration per 24 hours is abnormally low?
A: Creatinine clearance test is the test that is used to assess the amount of this protein in the urine…
Q: Give 3 examples of how biochemistry is involved in the recovery/treatment of sprain injury. explain…
A: A closed spinal cord injury system which is easily and reproductive infilcted is described . At…
Q: Briefly outline the location, isolation , characterisation, benefits, and limitations of adult stem…
A: The definition of a stem cell is a unspecialized cell that can renew itself and, in some cases,…
Q: a. What are the major symptoms of sickle-cell anemia? b. Describe two other features of this…
A: What are the major symptoms of sickle-cell anemia? Virtually all of the most important symptoms of…
Q: What are the advantages of potentiometric titrations over conventional titrations? Please explain…
A: Many compounds, mainly in pharmaceuticals, need high purity. In order to check for sample purity,…
Q: Liver cells proliferate excessively both in patients with chronic alcoholism and in patients with…
A: Alcohol is an apoptotic compound which means either cell can be killed because of necrosis or by…
Q: write the names of FMN and FAD requiring enzymes .
A: FMN ( flavin mononucleotide ) and FAD ( flavin adenine dinucleotide ) are the active moiety of…
Q: Which pathology leads to an increased risk of Alzheimer’s disease? Select one: a. Accumulation of…
A: Alzheimer's disease is a progressive disorder which affects the brain cells to waste away…
Q: components that are part of the synthesis of T3 T4?
A: Thyroid hormones are produced by thyroid glands which consists of thyroid follicles serving both as…
Q: How can benign tumors cause clinical problems? A. There is potential for metastasis B. They contain…
A: Benign tumours are harmless non cancerous tumours that grows only on one place.They cant invade or…
Q: Explain Monod Model. What are the pros and cons of Monod Model?
A: Monod model It is a mathematical model which uses an equation to study the growth of microorganisms.…
Q: Please describe the function of true activators? Please discuss the effect of ligand binding on the…
A: A true activator is a protein, which is also known as a transcription factor. The true activators…
Q: discuss the four types of attractive forces that give the raise to tertiary proteinstructure
A: The 3D structure or globular shape obtained as the result of side chain interactions between distant…
Q: 5. What are the two major constraints on further reductions in CT scan time?
A: CT scans are quick, painless and safe generally. But there's a small risk that a patient could have…
Q: The of satellite cells in the skeletal muscles can be found A. as a dispersed population of stem…
A: Myosatellite cells, often known as satellite cells or muscle stem cells, are small multipotent cells…
Q: What amino acid residues interact with methylphenidate in DAT and NET protein active sites? please…
A: DAT and NET proteins are Dopamine Transporter and NET is Nor-Epinephrine Transporter proteins, both…
Q: 7. Are proteins soluble in alcohol? Why or why not?
A: Proteins are made up of amino acids . Amino acids have similar backbone structure but they differ in…
Q: Which of the following statements is/are true about collagen? a) It gives epithelial layers…
A: Collagen gives epithelial layers tensile strength and allows them to stretch. hydroxylation of…
Q: Describe a Rho independent terminator and tell how it works.
A: Termination involves recognition of a point at which no further bases should be added to the chain…
Q: 1. Explain the formation of thioether-linked prenyl anchor proteins and also explain the structure…
A: We have studied integral and transmembrane proteins but actually, Lipid groups, are attached to some…
Q: 38. What are the principal tissue stains used in histology and describe where and what color each…
A: The correct option is A The hematoxylin stains cell nuclei blue, and eosin stains the extracellular…
Q: 3) Where is TTX obtained from? 4) What was the effect of Lidocaine?
A: Kindly don't post multiple questions at a time. Post each question individually. According to…
Q: 18. What if you or a member of your family, your child had one of these disorders? What if your…
A: Introduction The letters used to identify the DNA nucleotide bases make up the whole word…
Q: 5--ATTGAGGATСССТААТGTGTССTGATCACGCTССАТА-3 3'ТААСТССТАGGCATTACACAGGACTAGTGCGAGGTAT -5'
A: BamH1 is Restriction endonuclease enzyme which cleaves at specific sequence and produce sticky ends…
Q: 12: Name the cell type at the tip of the pointer.
A: These provide support, structure, mechanical strength and flexibility to the people, lead veins…
Q: Urinary casts are classified as cellular or acellular (e.g., hyaline, waxy, fatty, red or white…
A: Urinary casts are microscopic tube like structures found inside the urine . It is common to have…
Q: Explain how scaffold proteins help the efficiency of the AMP kinase cascade. Why is it important…
A: The scaffold protein plays a key role in providing the platform for the specific…
Q: 6. Increasing the aldosterone secretion during prolonged muscle activity in hot weather allows you…
A: Aldosterone It's a hormone that helps keep your Bp (blood pressure) in equilibrium. It keeps your…
Q: State some of the features that cross the cell membrane and make "porin proteins" specific.
A: As per the honor code, we answer only one question at a time, therefore we are answering the first…
Q: 20. What is an “R on T phenomena?
A: The Heart is a vital organ which supply the blood to the all the body organ and the cell so when…
Step by step
Solved in 2 steps
- Give typed full explanation Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’1e) Give the sequence of every codon this tRNA, with the anticodon 5'AGG3', could base pair with (perfect and wobble matches), and name the amino acid coded for by each codon whose sequence you have written.2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation 5'TAA3' (which will be transcribed into 5'UAA3' in the mRNA - but recall that mutations are changes in the DNA sequence). Name all the amino acids that could have been coded for by the original, unmutated codon at that position in the gene.
- 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched by a tRNA anticodon that is its perfect complement), how many tRNAs would be required to service all of the threonine codons?If a new isolated protein called STICKY and this STICKY protein contains a bHLH domain. Now, how we predict the function of STICKY and the rationale for the importance of these domains in the STICKY function?Which anticodon would you predict for a tRNA speciescarrying isoleucine? Is there more than one possible answer? If so, state any alternative answers.
- Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs required to service all of the threonine codons? Write out the base sequences of the anticodons of those tRNAs (remember to label the 5' and 3' end of each anticodon sequence).(a) Write a possible sequence for an mRNA segment coding for apamine.(b) Do you think apamine is synthesized in the form, or is it more likely a product of proteolytic cleavage of a larger peptide? Explain.
- Based on the data shown where is the DNA binding domain? Explain which constructs helped you reach this conclusion? Which part of the protein is the Activation domain? Explain which constructs helped you reach your conclusion?From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?