Answered: Give typed full explanation Given the…

Give typed full explanation Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: The model shows the process of meiosis. Use the model to describe how genetic continuity is…

A: We are given a diagram showing how chromosomes are transferred from parents to offsprings with…

Q: outline of basic DNA repair mechanisms or can be put into a flow chart

A: Introduction DNA repair is the process by which cells identify and correct any damage or errors in…

Q: Supply four of the pieces of advice the text provides for successful dieting and weight loss. How…

A: The following four pieces of advice will help you successfully eat and lose weight: 1.Keep an eye…

Q: 1. Rob, 22 year old construction worker is non-smoker and maintains healthy life style. He is…

A: Antidiuretic Hormone: ADH stands for antidiuretic hormone, which is a hormone produced by the…

Q: 1. The strain X of mice is highly susceptible to skin cancer and was used to study the immune…

A: Introduction: Immunity refers to the ability of an organism to resist or defend against harmful…

Q: Including the sex chromosomesthe chromosome number of a normal human cell is 23 and the chromosome…

A: Introduction HeLa cells are the cancer growth cells which is taken from an African lady named…

Q: "On the rapidity of antibiotic resistance evolution facilitated by a concentration gradient" Full…

A: Antibiotic resistance evolved naturally in response to the selective pressure of antibiotic use.…

Q: Cross the following two genotypes: Aa Bb Cc Dd Ee x Aa bb Cc dd Ee. What is the proportion of AA Bb…

A: Mendelian genetics is also known as classical genetics that involves the study of the inheritance…

Q: Which of the following are involved in protein secondary structure? select one or more : a.…

A: Proteins are complex molecules that catalyse biochemical reactions, provide structural support, and…

Q: 2. If a plant begins the process of photosynthesis with 50 kCal worth of light energy, how much…

A: Photosynthesis is the process in which the light energy is converted into chemical energy by leaves…

Q: A. In the following table, indicate which of the sequences would be a possible restriction…

A: Most restriction enzymes only break down one phosphodiester bond on every strand and may detect…

Q: In humans, normal skin color (A) is dominant over albino (a). An albino man marries a normal woman…

A: Alleles are passed down to the organism's progeny. They come in two varieties: dominant alleles and…

Q: Question 5 Except for the all secondary lymphoid organs have thymus; high endothelial venules O…

A: Secondary lymphoid organs are specialized tissues in the lymphatic system that play a key role in…

Q: 6. Individuals 8 and 9, Generation IV in Family B are sisters. Based on yo inheritance claims, what…

A: The genotype is the combination of the alleles for a gene. For example if the gene for colour is H,…

Q: We are required to create a certain topic on our Evolutionary Biology class. And the topic is what i…

A: Antibiotic resistance evolution facilitated by a concentration gradient is a complex and concerning…

Q: What are the products of photosystems II and I in noncyclic electron flow? Draw a Z-scheme shows the…

A: In the light-dependent processes, there are two different types of photosystems: photosystem II and…

Q: The decline in the number of motor neurons coincides with the appearance of pyknotic cells, which…

A: Introduction: Pyknotic cells are those that have experienced apoptosis, or "programmed cell death,"…

Q: Show lineage of at least three clades starting from either Parazoa or Eumetazoa and show phylum (and…

A: Organism that belong to eumetazoa have specialised tissues. These organisms can be divided into two…

Q: when atrial natriuretic peptide is injected into an experimental animal, which of the following is…

A: Atrial natriuretic peptide (ANP) hormone is secreted from the cardiac atria (right atrium mostly)…

Q: Give typed explanation of all three otherwise leave it A patient is on a sodium bicarbonate 50 mEq…

A: The concentration of sodium bicarbonate in the infusion is 50 mEq/1000ml or 0.05 mEq/ml. To achieve…

Q: 5) What is current classification of organisms largely based on? Which biological molecule is…

A: A classification system is a way of categorizing or grouping objects or organisms based on their…

Q: "Extract of anethum graveolens' antibacterial property against staphylococcus aureus to assist wound…

A: Antibacterial property refers to the ability of a substance or agent to inhibit the growth or kill…

Q: Did the authors discover any microbes present that should be cause for concern, in your opinion (and…

A: Gouda cheese is a popular semi-hard cheese that originated in the Netherlands. It is typically made…

Q: speculate and discuss on the origin of the eukaryotic cells. Cite some examples in your answer

A: Prokaryotic cells lack membrane-bound organelles, whereas eukaryotic cells do (including the nucleus…

Q: Amikacin Antimicrobials Amoxicillin/clavulanate Ampicillin Cefazolin Cefepime Ceftriaxone…

A: Excessive Zn++ in the medium can have various effects on different groups of living organisms.…

Q: One of the effects of climate change on ecological communities is the disruption of seasonal timing…

A: Narrow-sense heritability is a measure of how much phenotypic variation in a trait can be attributed…

Q: Stem cell for Rheumatoid arthritis treatment Mesenchymal Stem/Stromal Cells for Rheumatoid Arthritis…

A: Introduction The autoimmune illness rheumatoid arthritis (RA) affects the joints, producing…

Q: Design Layout References Mailings Review View ACROBAT 12.5 A A Aa-EEEE alibri - IU-abe X₂ x² A-ay-…

A: Introduction: Messenger RNA (mRNA) is a molecule that plays an important function in gene…

Q: Characterize and identify the Genus of the following cyanobacterium Genus Identification of…

A: Cyanobacteria, also known as blue-green algae, are a group of photosynthetic bacteria that obtain…

Q: A marine ray (a euryhaline, osmoconforming, ionoregulator) moves its way from seawater to…

A: Introduction A marine ray is a type of cartilaginous fish that belongs to the family of rays, which…

Q: Echinoderms have a water vascular system, which is a key trait of this phyla. Select the features of…

A: Echinoderms This refers to a phylum of marine invertebrates that includes starfish, brittle stars,…

Q: Calculate the Chinese %NRV per serving for scallion oil and chili oil. (There is no need for %NRV…

A: To calculate the Chinese %NRV per serving of 30 grams, we need to compare the nutritional value of…

Q: The processes involved in Photosynthesis and Cellular Respiration have many differences in the…

A: Photosynthesis is the process by which plants and other photosynthetic organisms convert light…

Q: Replication of nuclear DNA begins at the Ori (origin of replication). True or false

A: Introduction Replication is the process by which a cell makes a copy of its DNA. It is an essential…

Q: Below are the ingredients of a heirloom recipe of Ana's family. Identify the organisms for each of…

A: Understanding the source of our food is essential for appreciating the complex web of life that…

Q: an you please annotate the two images attached. Also send a picture of the parts where you…

A: Annotation for figure 1

Q: Why do type 1 and type 2 diabetics need to work so much harder to maintain glucose homeostasis than…

A: Diabetes is a metabolic disorder characterized by high levels of glucose (sugar) in the blood. This…

Q: Is bone marrow a type of tissue? Is cartilage a type of tissue?

A: Introduction A collection of like cells that collectively carry out a particular task for the body…

Q: If you wanted to use the molecular clock to estimate times of divergence for phylogenetically…

A: Introduction: A gene is a segment of DNA that contains the instructions for the development,…

Q: Which brain nucleus is larger in female rats compared to male rats? a) Anteroventral periventricular…

A: SDN-POA, is typically larger in male rats than in female rats. SNB is a region in the midbrain that…

Q: The KEGG pathways (ribosome biogenesis and protein processing) indicate that the attachment of…

A: Glycosylation is the attachment of carbohydrates to proteins and is a common post-translational…

Q: a) In the effect of mitoxantrone on histopathological changes in the brain section of the results…

A: Introduction Axons are long, slender extensions of nerve cells, also called neurons, that transmit…

Q: State an example of a virus from the following viral families and describe the infection it causes.…

A: A viral infection is a type of infection caused by a virus, which can invade and multiply within…

Q: Please watch this video and answer the questions. What is a Tagine (it is more than one thing)?…

A: Nutrition is the study of how nutrients in food are processed, absorbed, and utilized by the body…

Q: Why have we chosen a human Rab protein with no direct yeast equivalent as an “outgroup” for this…

A: Rab proteins are a family of small GTP-binding proteins that play a key role in regulating vesicle…

Q: Which of the following would result in offspring MOST genetically similar to its parent? a whiptail…

A: The correct answer is (d) an aphid arising from asexual reproduction. Asexual reproduction involves…

Q: Case / Project B The Sacramento County Coroner's Office recently recovered skeletonized remains that…

A: Humans are a species of bipedal primates belonging to the genus Homo and the family Hominidae. They…

Q: Biological evolution is best defined as A. the process of direct observation B. unchanging nature of…

A: Biological Evolution: Biological evolution refers to the process by which species of organisms…

Q: Some types of antibiotics can permanently destroy hair cells near the base of the cochlea, close to…

A: Introduction Hearing loss is a partial or total inability to hear sounds in one or both ears. It…

Q: 10. The baker's yeast Saccharomyces cerevisiae is able to make uracil from simpler compounds…

A: Based on the complementation test results, we can determine the number of different genes…

Question

Give typed full explanation

Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.
Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. Use the table and write the sequence of the resulting peptide. Is it possible for a codon to code for another amino acid? What will be the effect if a mutation changes the codon UAU to UAA? What is a reading frame? If you are given a nucleotide sequence, how would you find Open Reading Frames? DISCUSS the reason why there are leading and lagging strands in replication?
A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.
To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.
Describe the helix-turn-helix (HTF) motif?
Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids of a protein : The first three underlined base pairs indicate the frame and include the coding region . 123456789 A. Write the peptide sequence of the last 6 amino acids of the protein . Label both ends of the peptide . B. A insertion of one base pair causes the protein to decrease in length by 5 amino acids . With respect to the sequence given above , where does this insertion occur , and what base pair will you insert ? C. An change of one base pair leads to the protein to increase in length by one amino acid. With respect to the sequence given above , which base pair would you change ? How would you change this base pair for the protein to increase in length by one amino acid ?
For the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.
Please determine the order of aminoacids from a given genetic code? 5’-UGGUACGGUACUCCAC-3’
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’a. What is the mRNA transcript of the anticoding strand of the DNA model?
Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.
VISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.