Add the following to 400ml H2O (not from the tap!) 5.4 g Tris base 50.0ml 10X Boric acid (55.0 mg/ml) 2.0ml 0.5M EDTA solution Adjust the final volume to 500ml with additional H2O, transfer to a bottle and label it as you will need this next week. Calculate the molarity of the tris, boric acid and EDTA in the 1X solution (to 2 decimal places).
Q: 4
A: Given :- Cu-Ni alloy contains 64 wt% Cu and 36 wt% Ni. wt% of Cu in liquid is 54% and in solid is 3...
Q: 1.08 g H2 is allowed to react with 9.83 g N2 , producing 1.36 g NH3 . Part A What is the theoretical...
A:
Q: Draw the skeletal structure corresponding to the systematic name of the molecule: 4, 5, 5 - triethy...
A: Given :- systematic name of compound = 4, 5, 5 - triethyl- 2, 2, 4, 6 - tetramethylheptane To draw...
Q: how much heat will be given off when 18.5g of C2H4 is burned in oxygen form CO2(g) and H2O(g) for th...
A: The combustion enthalpy of C2H2 of 18.5 g can be calculate with the help given stoichiometric equati...
Q: H. ОН PCC .COOH COOH or Na,Cr,0/ OH HNO, or HOAC KMNO, or NaOCI Cyclohexanol bp 161.5°C, den. 0.96 M...
A: The required mechanism is shown below Here initially oxidation of secondary alcohol to a ketone occ...
Q: complete total synthesis of Delta9 THC (all the steps of the mechanism).
A: Total synthesis of Delta9 THC: Total synthesis: Total synthesis is the complete chemical synthesis o...
Q: How many molecules of water occur per formula unit of MgSO4. Write the complete formula of the hydra...
A:
Q: Balance the given molecular equation using redox (electron-transfer method). Identify the element ox...
A:
Q: Problem 48 - IR spectrum Problem 48 C10H200 40- MW = 156 35- 30- 25- 20- 15- CDC1; 10- 3500 3000 250...
A:
Q: Identify the peaks and structer.
A: 13C-NMR shows an non-equivalets of the carbons in the spectrum. The number of signals in the spctrum...
Q: Write the ionization constant expression for a 50 mM aniline solution (pKb=9.40 @ 25 C).
A:
Q: Consider the following table: Name Formula Conjugate Acid 1.8 x 10 5 4.38 х 10 4 NH3 NH,+ Ammonia Me...
A: For best buffer solution pH of the solution should be equal to pKa of acid. For effective buffer so...
Q: Problem 20 - IR spectrum Problem 26 100- C;H10,Br MW = 238 80- 60- - CDCI; 40- - CDCI; 20- 3500 3000...
A:
Q: 2. Meanwhile, Jenny is given 250 mL of solution which is 0.0376 N Magnesium iodide from a pure solid...
A:
Q: 1.08 g H2 is allowed to react with 9.83 g N2, producing 1.36 g NH3. Part A What is the theoretical y...
A:
Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show...
A:
Q: Estimate the λmax of the following organic compounds. Show your solutions and/or analysis.
A:
Q: Balance the following chemical equation (if necessary) for the combustion reaction of propane: C3H8(...
A: In multiple questions we solve only first question according to Bartleby guidelines. Balance the ele...
Q: This is the excessive bending of bonds exhibited by a carbons at the point of rotation which creates...
A: Strain arises due to the repulsion between the bond electron of the molecule . So the molecule are a...
Q: pka E
A:
Q: Suppose a 3.00 L scuba tank is filled with about 29.7 moles of air at the ocean surface. If the tank...
A:
Q: O Parap Build a С Нow N Co x G Eleme bc46d6c41bbfdf9#10001 E Reading list 15 of 21 Review| Constants...
A:
Q: 5) Suggest the reagents required to produce the ff compounds: А. H. - CH3 В. С. :0: air,
A:
Q: 2. What is the mass of KHP that you will weigh? a. The instructions read "Weigh out accurately 700 t...
A: answer :
Q: Complete the table below for calculating the molar mass of the ionic compound chromium(II) sulfide. ...
A: Given, Chromium (II) sulfide.
Q: pH
A:
Q: What is the correct chemical waste of Ammonia and Diethylamine A. Down the sink B. Con...
A: Answer :
Q: Consider the following equilibrium reaction: C= D and Figure 2 to answer the questions below! c. Why...
A: The answer is as follows:
Q: What coefficients (in order from left to right) are needed to balance the following chemical equatio...
A: Given, ___Fe2O3(s) + ___C(s) → ___Fe(s) + ___CO(g) Coefficients are needed to balance the above equa...
Q: Reaction of hydrogen and nitrogen to form ammonia Hydrogen gas, H2 , reacts with nitrogen gas, N2 , ...
A:
Q: A certain reaction is first order in N, and second order in H,. Use this information to complete the...
A:
Q: • Which of the following radicals is expected to be the least selective? 1. HO• 2. F. 3. Cl• 4. Br• ...
A: Answer 2 :- Radical chain chlorination of 2,3-dimethyl pentane : 2,3-dimethylpentane 1 Alkane) rre...
Q: Rubbing alcohol is a commonly used disinfectant and has a cooling effect when applied to the skin. T...
A: Given, Common concentration of rubbing alcohol = 70 % (v/v) Concentration of isopropanol solution us...
Q: Complete the table below for calculating the molar mass of the ionic compound chromium(III) sulfide ...
A: A compound is formed by the electrostatic interaction between the cation and the anion. The cation i...
Q: how much heat Q needs to be supplied to the gas?
A: In this question wh have to calculate the heat Q needs to be supplied to the gas with teh help of m...
Q: BUFFERS CH3COOH and CH3COONa NH,OH and NH&Cl H3PO4 and NaH2PO4 H2CO3 and NaHCO3 NH3 and (NH4)2CO3
A: Buffers are the solutions which resist the pH change. Acidic buffer is the mixture of weak Acid/bas...
Q: The pH of pure water at 50°C. is 6.63. At 75°C the pH is 6.35. Compare Kw values at 25°C, 50.°C and...
A: Answer attached below
Q: 3. Propose an efficient synthesis to get the final product using malonic ester Hint: 6 steps to get ...
A: Solution If effcient synthesis to get the final product using malonic Ester..
Q: The equilibrium constant, Kp, for the following reaction is 1.57 at 600 K: CO(g) + Cl2(g) coCI,(g) C...
A:
Q: What is the final glycosidic link to be broken during glycogen debranching? a-1,3-glycosidic linkage...
A:
Q: Choose a balanced equation for the combustion of isoprene, CSH8, in an abundant supply of oxygen. Is...
A: • Isoprene gas on combustion reaction in presence of oxygen gas gives carbon dioxide gas and water v...
Q: Activity 2: Identify the intermolecular forces present among the following species. a. Two Sulfur di...
A: There are several types of intermolecular forces like H-bonding,dipole-dipole interaction , ion-dipo...
Q: A block of iron forming a pool of the liquid metal is correctly classified as A) Chemical change B...
A: Physical change : is the change of matter that occurs without change of the chemical composition. It...
Q: Some measurements of the initial rate of a certain reaction are given in the table below. [H] [4] in...
A: Given, [ H2] [ I2] Initial rate M/s 1.00 M 0.881 M 0.392 1.00 M 0.0933 M 0.0415 1.50 M 0.88...
Q: , Kgoal = ?
A:
Q: At a certain temperature the rate of this reaction is first order in NH,OH with a rate constant of 0...
A:
Q: Ka = 1.8 x 10-5 Ka1 = 4.3 x 10-7 HOAC H2CO3 %3D Ka2 = 5.6 x 10-11 Which of the following 0.01 M solu...
A:
Q: Predict the missing reactant of this biochemical reaction: ATP ADP kinase N. That is, in the drawing...
A: In the given reaction we have to predict the starting material. The starting material is shown below
Q: A certain reaction is second order in N, and first order in H,. Use this information to complete the...
A:
Q: Which of the following strategies is NOT used in the regulation of glycogen phosphorylase? O phospho...
A: Glycogen is stored at liver,muscle. Phosphorylation converts inactive form to active form. Regulatio...
Add the following to 400ml H2O (not from the tap!)
5.4 g Tris base
50.0ml 10X Boric acid (55.0 mg/ml) 2.0ml 0.5M EDTA solution
Adjust the final volume to 500ml with additional H2O, transfer to a bottle and label it as you will need this next week.
- Calculate the molarity of the tris, boric acid and EDTA in the 1X solution (to 2 decimal places).
Step by step
Solved in 3 steps
- A carefully weighed 280mg Calcium carbonate was used in the standardization of an EDTA solution. Initially, 25mL of the titrant was consumed but only after the addition of another 10mL of the titrant did an endpoint was visible.What is the MW of calcium carbonate?102 g/mol98 g/mL100 g/mL100 g/molWhat is the molar concentration of the standardized EDTA solution?0.08m0.8M0.08N0.08MHow many grams of EDTA (MW: 292 g/mole) is required to prepare 250mL of a 0.025M solution?0.18250.18521.8251.1852C1. A carefully weighed 280mg Calcium carbonate was used in the standardization of an EDTA solution. Initially, 25mL of the titrant was consumed but only after the addition of another 10mL of the titrant did an endpoint was visible. What is the MW of calcium carbonate? (use C1 as reference)* 102 g/mol 98 g/mL 100 g/mL 100 g/mol What is the molar concentration of the standardized EDTA solution? (use C1 as reference)* 0.08m 0.8M 0.08N 0.08M How many grams of EDTA (MW: 292 g/mole) is required to prepare 250mL of a 0.025M solution?* 0.1825 0.1852 1.825 1.1852Mr. Clean recently bought a laboratory-grade sodium carbonate from a chemical company known as Brand X. He was supposed to use it in the production of detergents. Unfortunately, he was scammed by the company. He suspected that he purchased a crude sodium carbonate so he tasked the Quality Assurance Department to determine the components of the purchased chemical. The chemist assigned to analyze the sample used double indicator method. For the standardization of HCl titrant, 0.1025 g Na2CO3 of 99.5% purity (FW: 106.00) required 8.20 mL of the titrant to reach the phenolphthalein endpoint. FW: NaOH (40.00), NaHCO3 (84.01), Na2CO3 (106.00) a. What is the molarity of the titrant? The chemist obtained a 3.150 g sample and dissolved it in distilled water to produce a 50.0 mL solution. An aliquot of 10.00 mL was obtained and diluted in a 100.0 mL volumetric flask. A 50.00-mL aliquot of the diluted sample was taken and it required 25.70 mL of titrant for the methyl orange endpoint, while…
- Following the monograph procedure, determine the weight in grams of sodium carbonate (MW-106 g/mol) used to standardize a 0.987 N sulfuric acid solution. 1. Consider that the burette was completely filled to the 0 mL mark before titrating. What is the volume of titrant consumed based from the image below? A. 22.9 mL B. 21.2 mL C. 21.3 mL D. 22.7 mL 2. What is the unknown weight (grams) in the problem? Your Answer:Bay Water Titration The concentration of Cl- in ocean water is about 500-600 mM. The baywater is diluted by a factor of 12.5 using a 20.00 mL volumetric pipet and a 250 mL volumetric flask. Using a 15.00 mL volumetric pipet, 15.00 mL is transferred into three clean Erlenmeyer flasks. 10 mL of 1% dextrin solution, 20 mL of de-ionized water, and 3-4 drops of indicator are added and titrated each with the AgNO3 solution. From the procedure, find: Dilution factor Volume of diluted bay water Then calculate: The [Cl-] of diluted bay water The [Cl-] of bay water Consider this information: [AgNO3] = 0.04043177 trial # Veq 1 13.91 2 13.73 3 13.9 4 13.86 5 13.87 6 13.84 average 13.85167 [Cl-]Bay = ([AgNO3](Veq(ave))/Vdil bay water pipeted) (Vflask/Vbay water)The total cation content of natural water is often determined by exchanging the cations for hydrogen ions on a strong acid ion-exchange resin. A 25.00 mL sample of a natural water was diluted to 100.00 ML with distilled water, and 2.06 g of a cation - exchange resin was added. After stirring, the mixture was filtered and the solid remaining on the filter paper was washed with three 15.00 mL portions of water. The filtrate and washings required 16.30 mL of 0.0282 M NaOH to give a bromocresol green end point. a) Calculate the number of millimoles of cation present in exactly 1.00 L of sample. b ) Report the results in terms of milligrams of CaCO3 per liter. Only typed solution.
- Compute the molarity of KMnO4 solution if 1.0092 g of pure FAS required 25.11 mL of KMnO4 solution to reach end point in an acidic medium. An impure sample of FAS weighed 1.2352 g and it required 26.01 mL of KMnO4 solution (use molarity from Q#2) to reach end point in an acidic medium. Compute %Fe in this sample.Suppose you are given 0.0856ppm to be the concentration of dissolved lead found in pond water after dilution factor of 1:100 in 100ml volumetric flask and the other sample is diluted at the dilution factor of 1:2 and the concentration is 2.14ppm. How would you comment on the amount of lead in pond waterA commercial vinegar was analyzed by titration to determine the percent acetic acid. Briefly, 10.00 mL of vinegar sample was diluted to 100. mL solution in volumetric flask. A 25.00 mL aliquot from the diluted vinegar required 25.55 mL of 0.1005 M NaOH to reach the phenolphthalein endpoint. Which is the correct equation between the analyte and titrant reaction? CH3COOH + NaOH → NaCH3COO + H2O 2CH3COOH + NaOH → NaCH3COO + H2O C20H14O4 + NaOH → NaC20H14O4 + H2O CH3COOH + 2NaOH → NaCH3COO + H2O
- In a Complexometric Titration Experiment, the preparation of the EDTA solution is as follows: In a 250 mL beaker, weigh 0.10 g MgCl2*6H2O and 1.0 g NaOH. Add approximately 200 mL distilled water and stir to dissolve. Add about 2.0 g of EDTA and transfer the solution quantitatively to a 1-L volumetric flask. Dilute to the mark with distilled water. What is the purpose of adding MgCl2*6H2O? Please show COMPLETE solution.Standardization of EDTA was done using MgSO4 standard wherein a 50-mL aliquot of solution obtained from 0.480 g MgSO4 in 500 mL needed 39.4 mL of the EDTA solution to reach the endpoint. Determine how many milligrams of CaCO3 will react per mL of this EDTA solution.Please help me out with making flowchart with thes steps. Write the result. Procedure 1. Place 20 drops of each of the following aqueous solutions to separate centrifuge tubes: 0.1M Cr (NO3)3, 0.1M Al (NO3)3, 0.1M Co (NO3)2, 0.1M Zn (NO3)2, 0.1M Mn (OH)2, 0.1M Ni (NO3)2, 0.1 M Fe (NO3)3. Make each solution basic by adding few drops of 6M NH4OH. Confirm using a litmus paper. 2. Add 5 drops of freshly prepared 6M (NH4)2S to each centrifuge tube. Place the samples in the centrifuge machine for 3 mins. After centrifuge record results. Decant the supernatant liquid of all the samples. 3. Add one drop of NH4OH in each centrifuge tubes. Add 20 drops of distilled water in each centrifuge tubes. Then add a few drops of 6M HCl in each solution. Place the samples in the water bath for 10 mins. After water bath, centrifuge the samples for 3 mins. 4. After centrifuge, add a few drops of 6M NH4Cl in each sample. Decant the supernatant liquid in each sample. 5. To the centrifuge containing…