All organisms share a common coding system for their genomic information. The common features of heredity imply all of the following EXCEPT that O genes from one organism will often function in another organism. O the study of one organism's genes often reveals principles that apply to other organisms. O None of these answers implicate a shared coding system. O all organisms will have the same number of genes. O all life forms on Earth share a common ancestor.

All organisms share a common coding system for their genomic information. The common features of heredity imply all of the following EXCEPT that O genes from one organism will often function in another organism. O the study of one organism's genes often reveals principles that apply to other organisms. O None of these answers implicate a shared coding system. O all organisms will have the same number of genes. O all life forms on Earth share a common ancestor.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 11QP: When the human genome sequence was finally completed, scientists were surprised to discover that the...

See similar textbooks

Similar questions

A researcher examines genes for several proteins that are quite similar in both structure and function. He is interested in determining whether the genes form a multigene family and in working out which of the proteins arose first evolutionarily. What would be the BEST approach to take to address this question? Be careful to look for the best approach; some other approaches could also provide useful information while being less definitive. A. The researcher should sequence the genes and compare their sequences. The most similar genes are likely the most closely related, while those that have more base differences probably diverged earlier. B. The researcher should examine the functions of the proteins. Those with the most similar functions are the most closely related. C. The researcher should induce mutations in the genes to see how these affect the function. The most mutations needed to cause changes in the function of the protein, the older the gene. D. The researcher should…
When the human genome sequence was finally completed, scientists were surprised to discover that the genome contains far fewer genes than expected. How many genes are present in the human genome? Scientists have also found that there are many more different kinds of proteins in human cells than there are different genes in the genome. How can this be explained?
Geneticists can synthesize any gene—any stretch of DNA—desired. Suppose you use a tree of genome evolution to predictthe structure of a now nonexistent, ancient gene. What insightsmight you obtain by synthesizing the ancient gene and insertingit into a living animal?
The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.
The existence of ubiquitous genes and proteins (performs the same function in all organisms) strongly support the theory that all life evolved from a common ancestor. With that in mind, what kind of genes might be evolutionarily conserved and universally found in bacteria, plants and animals? Select one: a. genes that code for the synthesis of ribosomes. b. genes that code for the enzymes of glucose metabolism c. genes that code for the synthesis DNA and RNA polymerase d. all of the above. Clear my choice
Most variation between individual humans is in the form of ______________________. One of the basic types of genetic change called _________________________ may arise by recombination within introns and can create proteins with novel combinations of domains. Scientists and government regulators must be very careful when introducing herbicide-resistant transgenic corn plants into the environment, because if resistant weeds arise from __________________ then the herbicides could become useless. Families of related genes can arise from a single ancestral copy by _________________________and subsequent ________________________. divergence purifying selection exon shuffling single-nucleotide polymorphisms gene duplication synteny horizontal gene transfer unequal crossing-over
When comparing evolutionary similarities between different genes within a gene family, it is usually more straightforward to compare genes by using the protein sequences of gene products rather than DNA sequences of the genes themselves. Explain why this is the case. (Include 4 succinct points at least)
The human genome holds an extraordinary amount of information about human development, medicine, and evolution. In 2000, the human genome was triumphantly released as a reference genome with approximately 8% missing information (gaps). In 2022- exactly 22 years later, technological advances enabled the gaps to be filled. This is a notable scientific milestone, leading to the resolution of critical aspects of human genetic diversity, including evolutionary comparisons to our ancestors. Discuss the sequencing technology used to resolve the human genome in 2005, its significant advantages and limitations?
The human genome holds an extraordinary amount of information about human development, medicine, and evolution. In 2000, the human genome was triumphantly released as a reference genome with approximately 8% missing information (gaps). In 2022- exactly 22 years later, technological advances enabled the gaps to be filled. This is a notable scientific milestone, leading to the resolution of critical aspects of human genetic diversity, including evolutionary comparisons to our ancestors. Discuss the sequencing technology used to resolve the human genome in 2005, its significant advantages and limitations? What was the technology used in 2022, and how significant are the gaps that have been resolved? What new insight will be gained from this new information- especially pertaining to understanding epigenetics?
The human genome holds an extraordinary amount of information about human development, medicine, and evolution. In 2000, the human genome was triumphantly released as a reference genome with approximately 8% missing information (gaps). In 2022- exactly 22 years later, technological advances enabled the gaps to be filled. This is a notable scientific milestone, leading to the resolution of critical aspects of human genetic diversity, including evolutionary comparisons to our ancestors. What was the technology used in 2022, and how significant are the gaps that have been resolved?
Our lives are surrounded byBig Data. Enormous quantitiesof personal informationare stored on private and public databases,revealing our purchasing preferences,search engine histories, social contacts,and even GPS locations.Perhaps the most personal of all BigData entries are genome sequences.Tens of thousands of individuals arenow donating DNA for whole-genomesequencing—by both private genesequencingcompanies and public researchprojects. Most people who donatetheir DNA for sequence analysis do sowith little concern. After all, what consequencescould possibly come fromaccess to gigabytes of As, Cs, Ts, and Gs?Surprisingly, the answer is—quite a lot.One of the first inklings of geneticprivacy problems arose in 2005, whena 15-year-old boy named Ryan Kramertracked down his anonymous spermdonorfather using his own Y chromosomesequence data and the Internet.Ryan submitted a DNA sample to a genealogycompany that generates Y chromosomeprofiles and puts people intocontact with others who share…
For each of the following examples, discuss whether the observed result is due to neutral mutations or mutations that have been acted on by natural selection, or both: A. When comparing sequences of homologous genes, differences in the coding sequence are most common at the wobble base (i.e., the third base in each codon). B. For a protein-encoding gene, the regions that encode portions of the polypeptide that are vital for structure and function are less likely to display mutations than other regions of the gene. C. When comparing the sequences of homologous genes, introns usually have more sequence differences than exons.