Answer the questions below "in context", in 60 words minimum. A) Why is it important to understand the cell cycle? B) In what health situations would you apply it to your decision
Q: Our intestinal tract is filled with probiotic bacteria which are the bacteria that help with food…
A: Antibiotics are the substances which are commonly used as a medication for the treatment of various…
Q: What is the Rhesus factor? Explain the complications that may arise from blood incompatibilities.
A: The "ABO" blood group system is made up of four blood groups – A, B, AB, and O and is based mostly…
Q: 9. Proteins synthesized in the rough endoplasmic reticulum are most often intended for: A. packaging…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: The pressure in the veins sufficiently high to drive the flow of blood into the heart is callec O…
A: The heart is a fist-sized organ that pumps the blood throughout the body. It is the primary organ of…
Q: Baldness - Itching - Blackhead - Small pinpoint hemorrhages – Describe the following types of burns:…
A: Burns can cause inflammation, blisters, scarring, pain, and even death in severe situations. They…
Q: honey bee colonies, the queen produces sterile offspring that protect the nest and forage for food.…
A: Every honey bee colony comprises of a single queen, a few hundred drones and several thousand worker…
Q: Give certain primitive characters with all members of kingdom Animalia (adapted from Krempels and…
A: Kingdom Animalia is a taxonomic kingdom that contains all animals. Animals are eukaryotic,…
Q: Your doctor has told you that you were recently infected with a PROVIRUS, and no matter what you do,…
A: Proviruses are genome of those viruses which are non active themselves and became active after…
Q: Why do we need several ways to measure species diversity
A: The word species diversity is self-explanatory inferring the variety of species in an ecosystem.…
Q: Compare and contrast the hydraulic skeleton of molluscs with the hydrostatic skeletons of cnidarians…
A: Organisms such as cnidarians and pseudocolomates got the hydrostatic Skelton, where as molluscs got…
Q: What is the recommended treatment of hypothyroidism by the American Thyroid Association guidelines.
A:
Q: What structures in Tiktaalik make it so important in the Water to Land Transition? Group of answer…
A: Tiktaalik was an extraordinary organism that existed about 375 million years ago. Tiktaalik had the…
Q: The period of ventricular contraction = O phase O of pacemaker action potential O phase 2 of…
A: Isovolumetric contractions occurs in The early stage of heart contractions. The period of…
Q: In the formation of a thioester bond, the involved hydrogen atoms: A) are transferred to NAD+ B)…
A: Thioester bond formation.
Q: true/ false Drosha and Pasha bind to mRNAs allowing the 43S subunit to form, but they inhibit the…
A: Drosha is a type III RNase, which plays a critical role in miRNA biogenesis. Pasha is an essential…
Q: Micropropagation can be achieved by (A) Self-pollination (B) Asexual reproduction (C) Tissue culture…
A: Introduction:- Micropropagation is the method of artificially propagating plants vegetatively using…
Q: In Labrador Retrievers, coat color is determined by one gene with two alleles. The B allele produces…
A: This question is based on genetics.
Q: What is the procedure of controlling the opening and closing of the stomatal pores?
A: The opening and closing of the stomata are controlled by the factors listed below:
Q: What are respectively some remarkable functions of myosin, CD4, albumin, keratin, immunoglobulin,…
A: Myosin is a molecular motor. It converts chemical energy to mechanical energy. It helps in actin -…
Q: A patient has arrived at the doctor complaining of acute respiratory symptoms (cough, runny nose,…
A: a) No.Antibiotics are drugs that kill bacteria germs and can only treat sickness caused by bacteria,…
Q: What factors contribute to the change in the shapes of the population pyramids in 1945 and 2050?
A: There are a number of types of population pyramids depending don't numerous factors such as…
Q: Match the test with the correct description
A: A mineral is a naturally occurring inorganic element or compound having an orderly internal…
Q: Under normal conditions, pressures in the left and right ventricles are equal during systole. * true…
A: Answer--
Q: PrfA is a protein that serves as a global regulator of virulence genes in Listeria, a bacterium that…
A: The bacterium Listeria sp. is a pathogenic bacterium that is responsible for causing listeriosis.
Q: Water absorption from the soil with the help of root hairs involves which types of forces?
A: As a result of the transpiration pulled by aerial plant parts, a negative pressure is exerted down…
Q: The enormous flower stalks of an Agave plant represent which of the following? Agaves are…
A: * Semelparity and iteroparity a the reproductive strategies for living organisms * A species is Said…
Q: 26) Which cells are no longer capable of carrying out the process of DNA transcription? A) xylem B)…
A: DNA transcription is the process of copying a DNA sequence into RNA. This copy, or transcript, can…
Q: In a dihybrid cross AA bb x aa BB, what proportion of the F2 offspring is expected to be…
A: P: AAbb x aaBB F1: AaBb Selfing of AaBb AaBb x AaBb AaBb gametes : AB, Ab, aB,…
Q: Which of the following is part of the second line of defense? a. Interferons b. Phagocytes c.…
A: The immune system shows immune response in three stages the first line of defence includes the…
Q: If a person sustained damage to their brain stem, what could be the possible consequences to their…
A: Brain stem injury can lead to various adverse effects. Some may be threatening to life and some may…
Q: ello, please answer the following Microbiology question correctly. *If you solve the question…
A: Water- a substance that is composed of the chemical elements such as hydrogen and oxygen with…
Q: Why is environmental filtering so crucial to community structure
A: Different populations living together and interacting with each other forms a community. Community…
Q: Why does pure water have maximum water potential?
A: The energy required to transfer an infinitesimal quantity of water from a sample to a reference pool…
Q: True or false: Neurotransmitter binding to a single GPCR can only activate a single G-protein. O…
A: G Protein-coupled receptors (GPCRs), also known as seven-transmembrane domains receptors, are a…
Q: Why do biologists care about phylogenies?
A: Phylogenies are important to biologists because they aid in their research. Reconstructing the past…
Q: True or false: The telomere-shortening theory is an example of a stochastic theory of cell aging.
A: It is thought that, as a cell divides, the telomeres become shorter and shorter each time until they…
Q: what organism would be most affected by a blightr that eliminates all plant material from an…
A: *plant diseases can be due to the pathogenic organisms like fungus and bacteria and mycoplasma or…
Q: Which of the following substances requires a transport protein in order to cross a membrane? Select…
A: The transport proteins are the channel protein that makes the specialised pores in the membrane for…
Q: can you illustrate and explain it
A: Gangliosidoses are a group of inherited metabolic diseases caused by a deficiency of the different…
Q: We use salting and freezing to preserve our food against bacteria. Explain why is food preserved…
A: Food preservation refers to the practices of food processing that reduce the deterioration of food…
Q: You are given two data sets that provide counts of F1 and F2 offspring with given genders and…
A: The data are generated from an initial parental cross. One parent displays the disease phenotype and…
Q: identify the organisms concerned in each type of spoilage: causes the flat, flipper, springer, soft…
A: *spoilage in canned foods is low but sometimes Swollen cans are spoiled products. *During spoilage…
Q: Question 7 Refer to step 7 of glycolysis (slide #25 or so) and define "substrate level…
A: Glycolysis Also know as embden-meyerhof-parnas pathway or EMP pathway. Glycolysis is the sequence…
Q: Why urine would have protein in it ? Please answer in short and ASAP .
A: Introduction Urine is a liquid by-product of metabolism in humans and in many other animals. The…
Q: Purple flower color in pea plants is completely dominant to white flower color. A pea plant…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Describe the coronavirus infection and disease spread using as many epidemiological terms as…
A: Answer Corona virus is an infectious disease caused by a virus called SARS-CoV-2.Anyone can be…
Q: What is the importance of preserving biodiversity?
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: Ways in which a resistant form of infectious disease can re-emerge include A when the vectors are…
A: Resistance to antibiotics is a normal occurrence. Antibiotic resistance, on the other hand, is…
Q: 7. Sulfonamides are uscd to treat bacterial infections. Why these medicines do possess antibacterial…
A: Sulfonamide is a practical gathering (a piece of a particle) that is the premise of a few gatherings…
Q: Main factors that affect stroke volume. preload contractility afterload autonomic nervous system
A: To understand the principles of cardiac stroke volume it is necessary first to define the cardiac…
Step by step
Solved in 2 steps
- 2. Explain what the cell is doing in each of the following stages of the cell cycle.a) G1, b) S, c) G2, d) M1. A defective white blood cell does not complete the process of DNA replication. Which of the following is most likely to occur during the cell cycle for this cell? a. The white blood cell will be stopped at the G1 checkpoint and sent to the G0. b. The G2 checkpoint will stop the cell from continuing in the cell cycle. c. The white blood cell will get stuck at the spindle checkpoint. d.The cell will continue on to cytokinesis. 2. Which of the following statements describes how the RNA sequence specifies the production of an amino acid chain? a. Each set of three bases codes for an RNA molecule that specifies the anticodon. b. Each set of three bases codes for a single amino acid. c. Each base codes for one amino acid. d. Each group of three bases codes for an enzyme that binds amino acids together. 3. What will most likely happen when the -35 element and pribnow box are mutated? a. RNA Polymerase II will not be able to bind to the promoter region. b. Prokaryotic RNA…Cytokinesis involves ... A.)division of the cytoplasm B.)a cleavage furrow (animals) or cell plate formation (plants) C.)the completion of the cell cycle D.)all of the above
- 1) Examine the picture of an onion root tip with cells in various stages of the cell cycle. A student claims that interphase is the longest stage of the cell cycle. Another student claims that mitosis is the longest stage. Using evidence from the photo, determine which student is correct and why. A) Mitosis is the longest stage because anaphase requires more time to separate chromatids. B) Interphase is the longest stage because chromosomes are visible in the majority of the cells. C) Mitosis is the longest stage because the majority of the cells in the photo are replicating their DNA. D) Interphase is the longest stage because the majority of the cells in the photo have uncondensed chromatin and are not dividing. Not GradedCells that DO NOT divide or participate in the cell cycle are usually arrested in what phase? a. S phase b. Prophase c. G2 d. G0 e. M phaseWhat is necessary for a cell to pass the G2 checkpoint? a. cell has reached a sufficient size b. an adequate stockpile of nucleotides c. accurate and complete DNA replication d. proper attachment of mitotic spindle fibers to kinetochores
- 1.What stage of mitosis is the cell undergoing? 2.Name a piece of evidence that helped you determine the stage. 3.What stage will it encounter next?Final preparations for cell division are made during this stage of the cell life cycle: (a) G1, (b) G2, (c) M, (d) S.1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
- 1. How do the daughter cells compare in size relative to the parent cell? 2. List several reasons for mitosis in plant or animal cells. Use complete sentences for full credit.1) Use your knowledge of the cell cycle to explain why onion root tip cells spend most of their time in this stage 2) complete table below of stages and reasoningDuring which stage of mitosis is DNA replicated. Use complete sentences for full credit. 4. During which stage of the cell cycle are the centrioles duplicated? Use complete sentences for full credit.
