e following statements may be either true or false. Please circle your answer. True / False RNAi-silencing occurs only in C. elegans but not in other organisms.
Q: There is no information about the function of this gene. What would you do to obtain the cDNA for…
A: NOTE- Since you have asked a question that contains multiple parts So keeping a note as per our…
Q: Consider the following mRNA molecules and the amino acids they code for. The second mRNA molecule is…
A:
Q: Which of the following statements is correct? Many prokaryotic, but not eukaryotic, mRNAs are…
A: The mRNA is the RNA molecule that regulates the process of protein synthesis by serving as a…
Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…
A: During mutation, there is a change in the overall sequence of the gene, which can result in a change…
Q: Progesterone is a steroid hormone (also described as a ligand) that prepares the body for pregnancy.…
A: Given: Progesterone is a steroid hormone(also described as a ligand) that prepares the body for…
Q: Complete Table 1, indicating how much (lots, little, none) of the above gene product would be made…
A:
Q: Which of the following is not an example of translational control of MRNA? Localization bicoid mRNA…
A: Translation is the process of synthesis of protein. The ribosomes, tRNA, rRNA are involved in the…
Q: Which of the following incorrectly describes the difference between eukaryotic and prokaryotic gene…
A: Prokaryotic organisms are single-celled creatures that lack the cell nucleus, and their DNA…
Q: Choose correct option and do explain plz. 1. The protein complex that helps RNA polymerase to…
A: a) SWI/SNF It is composed of various proteins and act as an ATP-dependent chromatin remodeling…
Q: sRNA acts as a marker, flagging the inhibitory protein for ubiquitination and allowing translation…
A: Proteins are synthesized by the process of translation and are modified after post-translational…
Q: Choose the model that correctly shows the regulatory relationships between the nanos, bicoid,…
A: Gene regulation is the process of regulation of expression of a gene. It means to regulate the…
Q: Which of the following statements uses the term homologous correctly?A. The two X chromosomes in…
A: Homologous genes refer to the genes that are inherited in two species by a common ancestor. These…
Q: Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR.…
A: Cystic fibrosis is a genetic disease that is characterized by the production of excessively thick…
Q: Below is a diagram of a gene that is not normally alternatively spliced. All four exons (represented…
A: Transcription is the synthesis of mRNA from the DNA. Northern blotting is used to study the mRNA and…
Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…
A: A mutation is a change in the sequence of the DNA that may affect the codons of the DNA or mRNA.…
Q: which one would be least likely to cause Liam’s disease? Group of answer choices A. Mutation 4 B.…
A: Promoter: Is short nucleotides sequences located at 5'end that aid in switching on and off of a…
Q: Which of the following statements regarding bacterial transcription is FALSE? Question options:…
A:
Q: You are teaching a class on the regulation of eukaryotic gene expression. such as the promoter…
A: Binding of RNA polymerase II and transcription factors is necessary for transcription.
Q: the diploid somatic nucleus of xenopus has 900 copies of rDNA and in the mature oocyte it could…
A: Transcription is a process in which DNA is converted to RNA.
Q: What region would provide cell type-specific expression of genes? region What site would…
A: The mRNA is given in the figure. The mRNA undergoes the process of translation to produce protein.
Q: One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is…
A: Hypokalemic periodic paralysis is a condition characterized by intermittent episodes of muscle…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: Protein synthesis or translation process involve at least three steps- In the first step there is a…
Q: B-thalassemia is a hereditary blood disorder that leads to the formation of an abnormal hemoglobin…
A: Answer is option A.
Q: What can you say about relative gene expression for the gene of interest, normalized to that of the…
A: The correct answer for the problem will be that the relative gene expression for the gene of…
Q: How would the following affect BOTH transcription and translation of a particular multi- exon gene…
A: Transcription and translation are two distinct processes that allow the expression of a gene.…
Q: The following eukaryotic DNA sequence is a made up gene. It contains a promoter (green), a coding…
A:
Q: A mutation in the trp repressor gene that prevents the apo-repressor from binding the co-repressor…
A: Tryptophan operon Tryptophan operon is negatively regulated operon, it includes five gene, promotor,…
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5'…
A: Nucleotides are the building units of nucleic acids. Nucleotides are divided into two types:…
Q: Discuss the mechanisms by which transcription factors influence the reprogramming of somatic cells…
A: Somatic cells are similar to human beings in that they develop to fulfill a specific purpose in…
Q: These are written as either accurate or contain errors. Rewrite each one with an error as an…
A: RNA polymerase is an enzyme responsible for the copying a DNA sequence into RNA sequence. That means…
Q: Complete Table 1, indicating how much (lots, little, none) of the above gene product would be made…
A: Transcription It is defined as the process of transcribing the segment of the DNA to the RNA, which…
Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…
A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the usual…
Q: Duchenne Muscular Dystrophy (DMD) is a disease that manifests in muscle weakness. It exhibits…
A: The mutation is the change in the nucleotide sequence that codes for the phenotype in an organism.…
Q: The human PAH gene encodes the enzyme phenylalanine hydroxylase. Deficiency of this enzyme activity…
A: Genetic disease is caused due to mutation in the gene that may result in malfunction of the gene…
Q: The following eukaryotic DNA sequence is a made up gene. It contains a promoter (green), a coding…
A: Most eukaryotic genomes are bigger and more complicated than prokaryotic genomes. Eukaryotic genomes…
Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An…
A:
Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…
A: Translation is the formation of protein from the mRNA in the cytoplasm.
Q: A 43-year-old man is diagnosed with chronic myeloid leukemia (CML) and started on standard imatinib…
A: Man with Chronic myeloid leukemia treated with imatinib therapy :-
Q: Cystic fibrosis (CF) is a genetic disorder affecting a number of organs, including the lung airways,…
A: many types of mutations are present which can explain the cause of the data we see above as cystic…
Q: What is the NCBI accession number (including the version) of the RefSeq Match for the first…
A: Acession number : It is distinguishing feature of a RefSeq record is the distinct accession number…
Q: Explain five ways that eukaryotic gene regulation is more complex than bacterial gene regulation?
A: Prokaryotes and eukaryotes differ in number of ways. We all are aware of this fact that eukaryotes…
Q: A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase…
A: Mutation refers to sudden change in the genetic material and is heritable. It may be on chromosomal…
Q: Which of the following does NOT pertain to the myoblast-determining gene 1?* a. It is a master gene.…
A: Developmental biology describes how interacting mechanisms generate an organism's various size,…
Q: does DNA encode the instructions to make us? Select all the true statements. Group of answer choices…
A: DNA is necessary for all living things, including plants. It plays a role in heredity, protein…
Q: In both prokaryotic and eukaryotic cells, gene regulation occurs primarily at the transcriptional…
A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…
Q: A particular gene in Drosophila shows MRNA transcript accumulation in both the anterior and…
A: In Drosophila, mRNA transcript of a gene is present both at the anterior and posterior regions of…
Q: Some events that occur during the expression of a neuronal glutamate receptor protein are listed…
A: The sequential events that occur during the expression of neuronal glutamate receptor protein are…
Q: Indicate whether the following sentences is either True or False and CORRECT the wrong sentences (…
A: Since you have posted multiple questions we solve the first question for you. To get the remaining…
Q: For each of the following RNA molecules: Indicate if it is Required or Not for translation in…
A: Question) Indicate if it is Required or Not for translation in prokaryotes and, if it is required,…
Q: Please choose the correct answer. If nutritional requirements are not met, gene expression will most…
A: Introduction Gene expression is the process through which information from a gene is utilised in the…
- The following statements may be either true or false. Please circle your answer.
True / False RNAi-silencing occurs only in C. elegans but not in other organisms.
True / False The same gene can be silenced by degradation of its mRNA in a parental animal, and by methylation of its DNA locus in the progeny.
True / False Drosha and Pasha bind to mRNAs allowing the 43S subunit to form, but they inhibit the formation of the 80S subunit.
True / False Injection of GFP-dsRNA into a C. elegans will activate the RISC complex and lead to the degradation of let-7 mRNA.
True / False Nuclear GFP fluorescence was used in most experiments because RNAi- silencing occurs in the nucleus and not in the cytoplasm.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
true/ false Drosha and Pasha bind to mRNAs allowing the 43S subunit to form, but they inhibit the formation of the 80S subunit.
by Bartleby Expert
- Indicate whether the following sentences is either True or False and CORRECT the wrong sentences ( please answer the two questions 1 and 2) : 1. People having defective APC gene are more susceptible to developing polyps (benign tumors) in the colon, and such APC mutations can arise spontaneously or be triggered by environmental mutagens. 2. Monomeric α-catenin binds strongly to E-cadherin-β-catenin; and the dimer binds to intergrins .Answer all the questions please. In both prokaryotic and eukaryotic cells, gene regulation occurs primarily at the transcriptional level. This is because early regulation of gene expression prevents the organism from needlessly expending energy and resources to produce proteins it has no need for. a. True b. False; most gene regulation occurs at the post-translational level c. False; only eukaryotic organisms regulate gene expression at the transcriptional level Transcription and translation occur simultaneously in eukaryotic organisms because both events take place in the cytoplasm. a. True b. False; transcription and translation occur simultaneously in prokaryotic organisms because both events take place in the cytoplasm c. False; transcription and translation occur simultaneously in both eukaryotic and prokaryotic organisms because both events take place in the cytoplasm The following is a template strand of DNA: 3' -…The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
- The human PAH gene encodes the enzyme phenylalanine hydroxylase. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. The first 9 amino acids of the wild-type human PAH protein are: MSTAVLENP The sequence below shows the first 9 codons of a mutant allele of the human PAH gene: atg tcc act agc ggt cct gga aaa ccc What type of mutation has occurred in the coding sequence? Group of answer choices silent frameshift nonsense missenseUsing the DNA nucleotide sequences for the wild-type and mutant genes in the following tables, determine the complementary mRNA sequence for the five portions of the Mc1r gene provided. (Note: You are only transcribing short portions of the DNA sequence for this protein. The actual gene contains 954 base pairs.) Using the mRNA sequence completed, determine the resulting amino acid sequence of the MC1R protein. (Note: You are translating only a portion of protein. The full protein is 317 amino acids long. The numbers above the columns in the tables indicate amino acid positions in the protein sequence.) You may use the genetic code chart providedCystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR. Studies of this gene have found that the Gene includes 250,000bp in the DNA. Scientists found that the mRNA had 6,500 nucleotides, and the final protein had 1480 amino acids. How much of the mRNA is untranslated? How much of the RNA that is produced does not leave the nucleus? One of the mutations that results in a disease phenotype can be easily identified because the mutation results in a much longer mRNA then normal. Where would you look for this mutation? What might this mutation have affected?
- Which of the following does NOT pertain to the myoblast-determining gene 1?*a. It is a master gene.b. It is a silencing gene.c. It produces a transactivating protein.d. It activates its own gene. Gene silencing involves which type of histone modification?* a. acetylation of histone 4 b. dimethylation of histone 3 c. trimethylation of histone 4 d. trimethylation of histone 3 Given the required environment, the totipotency of the nucleus can allow which of the following?* a. a committed cell to undergo dedifferentiation b. a committed cell to undergo terminal differentiation c. a terminally differentiated cell to produce a complete organism d. a terminally differentiated cell to produce specific types of tissues An induced pluripotent cell is described by which of the following?* a. It is a committed cell that undergoes redifferentiation. b. It is a committed cell that undergoes dedifferentiation. c. It is a terminally…ABOUT Phenylketonuria Explain Potential technical issues and limitations of PCR technology are mentioned Correct information about tissue that can be used to test for a genetic disease and justification of tissue selection Detailed information about the position (exact base pair number) of the new mutation relative to the sequence of the PAH gene. Numbering is based on the start of transcription of the PAH gene. PLEASE ANSWER ALLLL PLEASEETwist transcription factors (TF) play key roles in embryonic development and are largelyundetectable in normal adult tissues; however, their expression is reactivated during tumorprogression and correlates with invasive and metastatic lesions. Transcription of the Twistgene is activated by Wnt signals and the Twist TF represses the gene for E-cadherin.Answer the following questions as briefly as possible, based on what was presented in class,not an internet search (complex answers that go beyond class material may lose points)a. Outline the steps from the Wnt signal to the E-cadherin gene (inclusive);e.g., A → B → C (with some clarifications such as “binds to”, “activates”, “represses”)b. What are the normal cellular and embryonic (morphological) consequences of Twist expression?c. How would inappropriate expression contribute to cancer?
- These are written as either accurate or contain errors. Rewrite each one with an error as an accurate statement. Please have an explanation. Thank you! In eukaryotes RNA polymerase binds to the activator, specifically at the TATA box to align with the translational start site. Transcription Factors can have more than one function domain. One is the DNA-binding domain and the other is a trans-activation domain. Additive alleles function at one gene to contribute to the phenotype of an organisms, while non-additive alleles at that one gene do not add to the phenotype.Gene X codes for a protein in eukaryotes. A mutated eukaryotic cell contains an altered base-pair in an intron of gene X. Which would be the most likely effect of this mutation on the biomolecules in the cell? The amount of pre-mRNA transcribed from gene X would be less than normal. The amount of functional protein corresponding to gene X would be less than normal. The ability of snRNAs to form a spliceosome would be diminished. The breakdown of mature mRNA corresponding to gene X would be fasterTOH1 protein is typically expressed at the same level in kidney and stomach cells and is essential to appropriate function of both organs. TOH disorder is a disorder where no detectable TOH1 protein is present in kidney cells due to a mutation in the promoter leading to no transcription. No other organs are affected in TOH disorder. You used microarray analysis to examine cells from kidney and stomach cells from the same individual with TOH disorder. You labeled the cDNA from the affected kidney cells with red fluorescent nucleotides, and you labeled the cDNA from the unaffected stomach cells with green fluorescent nucleotides. After you mixed the cDNAs and allowed for hybridization, what color would you expect to see for the spot for the TOH1 gene when you analyze the microarray data? a) Red b) Green c) Black d) Yellow
