Are ray initials longer or shorter than fusiform initials? Can they undergo both periclinal and anticlinal divisions or just one or the other?

Q: What do you mean by neuroplasma?

A: Introduction: There is no such word called neuroplasma. It is either neoplasm or neuroblastoma.…

Q: What is third mutation of corona?

A: Coronavirus belongs to the family of Coronaviridae that causes upper respiratory infection. In 2019…

Q: How is information in the Mc1R gene used in a melanocyte to produce the Mc1R protein?

A: Melanocortin-1 receptor (Mc1R) is initially located on melanocytes surface. Melanocytes are the…

Q: What is the physiologicalcause of the syndrome knownas cretinism?

A: Creatinism is a hormonal disorder which occurs in the children. It is characterized by stunted…

Q: 2.2. Describe what are missense mutations and its effects on structure and function using…

A: Mutation is the basic cause of evolution. Mutation can be defined as any change in the chromosome or…

Q: How is information in the Mc1R gene used in a melanocyte to produce the melanocortin receptor (Mc1R)…

A: Melanocytes are the specialized cells that help to produce melanin pigment. Melanin pigment gives…

Q: 23. ID the region bracketing the letter 'A',

A: Question - 23 - ID the region bracketing the letter 'A'.

Q: Can anything be done for albinism, describe any innovative treatments that might be available for…

A: Introduction The term albinism usually refers to oculocutaneous albinism (OCA), a set of genetic…

Q: What is Guillain-Barré syndrome (GBS) ?

A: Autoimmune disorder is a type of disorder in which our own system attacks our body mistaken it as a…

Q: HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5'…

A: Restriction enzyme varies from one other in their restriction sites as well as the type of ends they…

Q: A lesion of the complete dorsal column at C2 will result is which of the following TPV & CP loss?

A: Spinal cord injury at C2 level is dangerous because it affects the respiratory function.

Q: What are sickle-cell animaia?

A: Blood is a body fluid in humans and other animals. It delivers necessary substances such as oxygen…

Q: MATCHING TYPE COLOUMN A COLOUMN B This cellular region contains numerous phagocytic vacuoles and…

A: The eye is the major sensory organ of our body as 80% of our senses are perceived by the eyes. It…

Q: affect the nucleus?

A: Vincristine have the ability to binds with the microtubular proteins of the mitotic spindle, which…

Q: How is the Mc1R gene synthesized from chromosomes and how does it produce itself into a melanocortin…

A: A DNA molecule comprises functional units called genes. Each gene provides instructions for a…

Q: Why is radiotherapy used for cancer treatment? What is the differance in palliative and curative…

A: Radiotherapy is a cancer treatment that uses high doses of radiation to kill and defeat cancer cells…

Q: 34. The correct order of the meninges (from neural tissue to bone) is A. Arachnoid mater : dura…

A: The meninges anr membranous structures thae help to protect as well as support the central nervous…

Q: Neuroglia outnumber neurons in the nervous system by about 10 to 1.In addition, neuroglia retain the…

A: Neuroglia or glial cells are the cells present in the CNS (central nervous system) and PNS…

Q: diagnostic imaging technique produce two-dimensional images using radon transforms of multiple x-ray…

A: There are three types of transforms and they are Trace transforms, Hough transforms and the…

Q: what is T h cell in a concept map form with 10 like words or phrases?

A: Concept maps is a type of graphical tool which is used to represent meaningful relationships in…

Q: Fifteen-year-old Dolores was embarrassed to talk with her mother about the pain she felt in her…

A: STD or sexually transmitted disease are infections which spread from one person to other mainly at…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia is a disease that interferes in the production of normal blood cells. It is a…

Q: Which of the following forms of rhodopsin forms a complex with transducin? Select one: a.…

A: The vision depends on the absorption of light energy by rhodopsin. Rhodopsin is a protein that…

Q: What is Zollinger Ellison Syndrome? How  it will cure? Please explain at your own words.

A: Zollinger- Ellison syndrome is a disorder in which the tumor is formed in the pancreas or in the…

Q: Bobby and Billy are brothers. They were exposed to a hazardous chemical, and Bobby contracted…

A: Multiple causation is a concept that states that any health issue or health related process may have…

Q: What is janus kinases (JAKs)?

A: Introduction  Cell signaling is the important phenomenon by which any cell responds to chemical…

Q: Can Turner syndrome be cured?

A: The genetic condition characterized by the absence of an X chromosome in the females. The ploidy of…

Q: 3) Explain giving appropriate reasoning why the neoblasts are considered the following

A: Hi! Since you posted many questions, we will be answering the first for you. Please post the other…

Q: 57. A 65-year-old man is brought to the physician by his wife. She says, "His appearance has been so…

A: Introduction :- The frontal lobes are the largest lobes in the human brain and the most commonly…

Q: Explain the consequence of the following structures.

A: The given structure represents the phospholipid molecules in a lipid bilayer. Phospholipids are…

Q: what is dementia. why is it diffcult to live with?

A: The brain consists of neurons that are fully matured at the time of birth. The repair and…

Q: What is the most significant difference between prion diseases and other diseases caused by amyloid…

A: Prions disease and Alzeimer dieases are both a neurodegenerative disease and share many common…

Q: What is palindrome ?

A: Palindrome is sequence of of word,pharse and other sequence of charecter which is same when we read…

Q: Clarify the use of the D and L designation vs. the (+) and (-) signs

A: Introduction D-L system (also called Fischer–Rosanoff convention) is used for naming α-amino acids…

Q: What is Senile plaques ?

A: Here we have to describe about senile plaques.

Q: Name the following cells

A: Blood consists of 55 % plasma and 45% blood corpuscles (RBC, WBC and platelets).  RBC is involved in…

Q: What role does the synaptonemal complex play? How is this complex different from cohesins?

A: Mitosis and meiosis are the two different ways that cells divide. When people talk about "cell…

Q: What are the indications of histograms with right elevation?

A: By the modern machines used for complete blood count plots a graph.  Histograms is a graphical…

Q: Fifteen-year-old Dolores was embarrassed to talk with her mother about the pain she felt in her…

A: As Dolores had felt the pain in her private parts, she should get consulted with the person who can…

Q: 5--ATTGAGGATСССТААТGTGTССTGATCACGCTССАТА-3 3'ТААСТССТАGGCATTACACAGGACTAGTGCGAGGTAT -5'

A: BamH1 is Restriction endonuclease enzyme which cleaves at specific sequence and produce sticky ends…

Q: The observation that schizophrenia is associated with duplications of a certain copy number variant…

A: CNV  has been observed in various disorders like AUTISM SPECTRUM DISORDER, SCHIZOPHRENIA,…

Q: Outline Knudson’s two-hit hypothesis of retinoblastoma and describe how it helps to explain…

A: The statistical analysis is performed by the Knudson on the retinoblastoma disorder. In this retina,…

Q: Which of the following statements is true with respect to the ribbon diagrams shown?

A: Proteins are the major structural elements of the cell. They are large biomolecules that are…

Q: Give the letters for the side groups that are likely to interact strongly with blood plasm NH NH,…

A: Proteins are polypeptide chains of amino acids. Amino acids can be both polar and non-polar.…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.