Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myleoid leukaemia? A. t(8;21) translocaton (RUNX1_RUNX1fusion) B. DNMT3A mutation C. TP53 deletion D. NPM1 mutation.

Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myleoid leukaemia? A. t(8;21) translocaton (RUNX1_RUNX1fusion) B. DNMT3A mutation C. TP53 deletion D. NPM1 mutation.

Name: Which ONE of the following molecular abnormalities is associated with
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myleoid leukaemia?A. t(8;21) translocaton (RUNX1_RUNX1fusion)B. DNMT3A mutationC. TP53 deletion D. NPM1 mutation.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter16: Human Genetics And The Human Genome

Section: Chapter Questions

Problem 6TYU

See similar textbooks

Similar questions

Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myeloid leukaemia Select one: A.t(8;21) translocation (RUNX1‐RUNXT1 fusion) B.DNMT3A mutation C.TP53 deletion D.NPM1 (nucleophosmin) mutation
Which ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the most favourable prognosis? Select one: A.Deletion of chromosome 5 B.Normal karyotype with FLT3 tyrosine kinase domain mutation C.t(8;21) translocation D.Deletion of chromosome 7
a.What would happen if IKKbeta did not phosphorylate IkappaB? b.Why is it so hard to make cytokine therapies? c.Why would you use the MyD88 independent pathway versus the MyD88 dependent pathway?
What is the Philadelphia chromosome? Briefly describe how it causes chronic myeloid leukemia.
2.2. Describe what are missense mutations and its effects on structure and function using haemoglobin as an example
The amino acid at the β82 position is in the central cavity that binds 2,3-bisphosphoglycerate in the deoxygenated form of hemoglobin. How would the mutation of Lys to Asn affect the ability to bind to 2,3-BPG? a. It would have no effect. b. It would have decreased 2,3-BPG binding. c. It would have increased 2,3-BPG binding. d. It would have increased 2,3-BPG binding at least two fold.
The head of the oncology divison of a large biotech company proposes to develop a therapeutic antibody to treat cancers with mutant B-Raf oncogene. Is this a good idea? Why or why not(limit 3-4 sentences)?
The p53 protein was discovered through its association with SV40 T antigen and assumed initially to be an oncoprotein. a. What is the current consensus as the function of p53 and what evidence caused this change in view? b. How does the effect of mutation in the p53 gene differ from the effect of mutation in the RB gene what is the molecular basis for this difference ?
Which of the following demonstrates the link between oncogenes and cancer? a.Oncogenes do not have mutations that increase the activity or number of molecules that stimulate mitosis. b.Oncogenes produce molecules that inhibit mitosis. c.They are genes that transform tumor cells into normal cells. d.The mutations in oncogenes increase the activity or number of molecules that stimulate mitosis, leading to irregular cell division.
Describe the mutational event that produces the MYC oncogene in Burkitt’s lymphoma. Why does the particular mechanism for generating oncogenic MYC result in a lymphoma rather than another type of cancer? Describe another mechanism for generating oncogenic MYC.
Mutations to proto-oncogenes act toa. increase cell division. c. repress oncogenes.b. increase DNA repair. d. decrease cell division
Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A. mucopolysaccharidosis type II B. Turcot syndrome C. Haemophilia A D. Xeroderma pigmentosum E. Haemophilia B F. Ataxia Telangiectasia G. Noonan syndrome H. Li-fraumeni syndrome I. Hunter syndrome J. Ocular motor apraxia