As a technique for detecting genetic variations, RFLP has substantial drawbacks. Name one such drawback, explain why it is unique to RFLP analysis with specific reference to the technique, and discuss why DNA sequencing overcomes this drawback.

As a technique for detecting genetic variations, RFLP has substantial drawbacks. Name one such drawback, explain why it is unique to RFLP analysis with specific reference to the technique, and discuss why DNA sequencing overcomes this drawback.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter4: Pedigree Analysis In Human Genetics

Section: Chapter Questions

Problem 4QP: Pedigree Analysis Is a Basic Method in Human Genetic: What does OMIM stand for? What kinds of...

See similar textbooks

Related questions

Q: Which of the following pairs of sequences would be considered different alleles in DNA profiling?…

A: DNA profiling employs highly variable conserved regions known as variable number tandem repeats…

Q: How is the color of the spot coverted into useful data if data is collected from a Vicrochip DNA…

A: DNA microarray is a chip-based technique where a collection of microscopic DNA spots attached to a…

Q: What are STRs, and why are they useful for DNA profiling?

A: Introduction In the genome there are usually two type of nucleic acid sequence present. One is Non…

Q: Your graduate advisor asks you to amplify the following sequence of DNA by PCR:…

A: The primer should be complementary to the region of template to be amplified.

Q: You need to amplify a gene from a source DNA for cloning in any cloning vector, which enzymes will…

A: The method of DNA cloning is used to produce the multiple identical copies of the specific template…

Q: Write a precise and accurate differential report on Sanger sequencing and next generation sequencing…

A: The process of DNA sequencing is the determination of the order of nucleotides present in the DNA…

Q: From your knowledge about DNA microarray, answer the following: Mention the name and the color of…

A: DNA microarray is basically a collection of microscopic DNA spots that are attached to the solid…

Q: Why the DNA sequencing alone is often not sufficient to produce a genome assembly of desired…

A: DNA sequencing is basically the process by which the nucleic acid sequence can be determined. the…

Q: Explain the Technical Issues Surrounding DNA Profiling ?

A: These concerns include fundamental human error and human discrimination, connecting innocent people…

Q: What is the useful of the Development of highly sensitive and low-cost DNA agarose gel…

A: In today's medicine, extremely sensitive and low-cost DNA agarose gel electrophoresis is widely used…

Q: When doing a lab that involves Extraction of Genomic DNA from adult Drosophila melanogaster. - What…

A: Due to their small size and minimal requirements, many Drosophila can be raised and tested within a…

Q: Why is the annealing temperature different between samples during DNA extraction & marker gene…

A: Introduction Polymerase chain reaction or PCR laboratort technique by which millions to billions of…

Q: Calculate the dynamic programming matrix and the optimal local and global alignment for the DNA…

A: a: GAATTC b: GATTA Scoring:- +2 for a match -1 for a mismatch -2 L for linear gap

Q: What is the program Finch TV used for? Viewing next generation sequencing data Opening sequencing…

A: Ans- C EXPLANATION- FINCH Tv is the tool or application used by the researchers to view, analyze,…

Q: RECOMBINANT DNA BRIEFLY, DESCRIBE RECOMBINANT DNA AND GIVE ONE CONCRETE EXAMPLE. EVALUATE THE…

A: Through recombinant DNA technology, we can clone our desired gene into a plasmid to get the desired…

Q: Why the sequence alignment is extremely important in designing a construct for developing a…

A: Sequence alignment It is defined as the way of arranging the sequences of DNA, RNA or protein to…

Q: Why a multiple sequence alignment is needed for researchers? What inferences can be derived from…

A: When three or more biological sequences are aligned and studied together, it is referred to as…

Q: For human genomic DNA what is the expected fragment size for high molecular weight DNA extracts?…

A: Gel electrophoresis is a technique used for the separation of proteins or nucleic acids based on…

Q: Is it necessary to cut the isolated genomic DNA of an organism with restriction enzymes for…

A: Restriction enzymes are also known as DNA-cutting enzymes which recognizes one or a few target…

Q: Can you please interpret and discuss and mark, this gel electrophoresis results. DNA ladder sizes:…

A: A molecular-weight/ size marker, also referred to as a DNA ladder, is a set of standards that are…

Q: Explain why DNA ladders are usually included during gel electrophoresis.

A: BASIC INFORMATION GEL ELECTROPHORESIS It is a process in which the DNA fragments are separated…

Q: Explanation of why mutations vary in likelihood of causing disease depending on location relative to…

A: Phenylketonuria is caused due to a genetic mutation in the PAH gene( phenylalanine hydroxylase…

Q: Describe two methods in performing a DNA analysis, its possibleapplications, and how it can be so…

A: DNA (Deoxyribonucleic acid) analysis is a method of determining the characteristics of the…

Q: Explain how substitution matrices can be used to improve the possibility of identifying related…

A: Protein is a macronutrient that is vital for building muscle mass. It is normally found in creature…

Q: What are the consequences for a DNA sequencing reaction if the ratio of dideoxyribonucleoside…

A: Introduction DNA is composed of nucleotides arranged in a specific sequence. Prior knowledge of DNA…

Q: Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of…

A: The molecule, which is responsible for the genetic inheritance in most living organisms is…

Q: the role (presence and absence) of a selectable marker (selection) in cloning a recombinant DNA…

Q: If you were to isolate genomic DNA from two people and perform restriction enzyme digestion followed…

A: Agarose gel electrophoresis is a technique for distinguishing DNA bands based on size. To…

Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: Microarray hybridization is used mostly in transcript profiling or assaying DNA variation. Although…

A: A usual microarray technology includes the hybridization of an mRNA with its original template of…

Q: What genetic method or technique would you consider as the most advanced? Why? In what fields of…

A: Gene is the Smallest unit of of heredity. Genes are the part of DNA which are responsible for…

Q: Describe the difference between Sanger based sequencing and Next Generation Sequencing (NGS). Why is…

A: Step 1 Sequencing is the establishment of the primary structure of an unbranched polymer. Sequencing…

Q: During PCR amplification in preparation for DNA sequencing, why were there different colors at the…

A: Polymerase chain reaction is a process by which millions of copies of a specific DNA segment are…

Q: From your knowledge about DNA microarray, answer the following: A- How DNA microarray is created?…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…

Q: The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being…

A: Polymerase chain reaction, or PCR, is a technique to make many copies of a specific DNA region in…

Q: Traditional Sanger sequencing has largely been replaced in recent years by next-generation and…

A: BASIC INFORMATION Gene Sequencing It is a process through which the arrangement of of the…

Q: What is the results of extracting the DNA of a strawberry?

A: Ripe strawberries are an excellent source for extracting DNA because they are easy to pulverize and…

Q: Cystic fibrosis can arise from a rare, short, in-frame deletion within the CFTR gene, which creates…

A: Cystic fibrosis (CF) is a disease that inherits and affects the lungs, digestive system, and other…

Q: The last steps of DNA extraction include washing it using ethyl alcohol and drying the DNA pellet.…

A: DNA is the genetic material present in the cells of living organisms.

Q: a) What are vectors? Describe extensively the roles vectors play in genetic engineering? Write short…

A: Note: Solving answer only for part A as per the guidelines, repost remaining part, please. The…

Q: what are the advantages and disadvantages of Gel electrophoresis in DNA analysis

A: Introduction :- Electrophoresis is a technique used in laboratories to separate DNA, RNA, and…

Q: PCR errors during library amplification are one possible source of false positive results. If an…

A: PCR is a polymerase chain reaction. This is a biotechnology used to amplify the DNA copies.

Q: Among all these primer pairs from Primer-Blast, which is the best to use for a PCR reaction and why?

A: The hereditary currency of an organism is the gene. The gene is present in the DNA of an organism.…

Q: If you have access to the necessary computer software, make asequence file and analyze it in the…

A: The sequencing of genetic information is important for proper study and analysis, and with the…

Question

Please leave the link for any sources used. Thanks!

Definition Definition Genetic variation refers to the differences in DNA sequence among individuals of the same species. These variations can occur due to mutations, genetic recombination, and natural selection. Genetic variation plays an important role in evolution, as it allows for the selection of traits that enhance the survival and reproduction of organisms in changing environments.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Aside from Sanger Sequencing, what are the other DNA sequencing methods that are available today? Search for all of them and TABULATE your results. The TABLE should compare Sanger sequencing with the other sequencing methods.
Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?
What is dideoxy sequencing? Explain it please.
Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?
Shown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'
Microarray hybridization is used mostly in transcript profiling or assaying DNA variation. Although the technology for establishing DNA microarrays was developed only recently, numerous applications have already been developed and their impact on future biomedical research and diagnostic approaches is expected to be profound. Give some examples of the practical use of this technique.
What are some difficulties with low copy number DNA analysis? What kinds of checks and balances can a laboratory employ to ensure reliability of DNA profiles coming from low amounts of DNA template
From your knowledge about DNA microarray, answer the following: Why RT-PCR is important in the sample preparation to perform expression microarray experiment?(
From your knowledge about DNA microarray, answer the following: A- How DNA microarray is created? and why it is referred to as “hybridization technology”? B- Why RT-PCR is important in the sample preparation to perform expression microarray experiment? C- Mention the name and the color of the dyes used in expression microarray? D- If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?
Traditional Sanger sequencing has largely been replaced in recent years by next-generation and third-generation sequencing approaches. Describe advantages of these sequencing methods over first-generation Sanger sequencing.
Why the DNA sequencing alone is often not sufficient to produce a genome assembly of desired reference-grade quality, particularly in eukaryotic organisms?
If you were to isolate genomic DNA from two people and perform restriction enzyme digestion followed by agarose gel electrophoresis, would this be an effective way to distinguish one person from the other? Explain. If not, what is another technique you might use to distinguish the two people?