As the helicase unwinds the dsDNA, which protein avoids annealing of the newly separated ssDNA molecules.
Q: Which of the following enzymes are needed to introduce foreignDNA into a vector?a. DNA gyrase and…
A: The tightly packed genetic material located in the nucleus of a living organism which is made up of…
Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…
A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…
Q: There was a mix of virus and E.coli DNA thats isolated and separated . One DNA sample had a base…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: A ssDNA solution is diluted by taking 3uL of a stock solution, which is made up to 60uL with water.…
A: Beer-Lambert law relates the attenuation of light to the properties of the material through which…
Q: Based on the gel profile shown above, which protocol do you think is the best for the butterfly…
A: Gel electrophoresis is a standard molecular biology procedure used for the separation of DNA by its…
Q: In recombinant DNA technology, restriction enzymes cleave the DNA at a specific site known as:
A: Restriction enzyme, also known as restriction endonuclease, is a bacterial protein that cleaves DNA…
Q: When a virus mistakenly picks up a segment of host bacterial DNA, packages it into a viral particle,…
A: There are many methods of DNA transfer in bacteria such as transduction, conjugation and…
Q: In a sample dsDNA from an organism, the amount of thymine is analyzed to be 12 μmoles when the…
A: In double stranded DNA the composition of bases follows the rule: A+T= G+C.
Q: Effect of Length of SSDNA on Pairing 1.25 1.00 0.75 0.50 1762 nucleotides 430 nucleotides 0.25 162…
A: In a graph, the dependent Variable belongs to the y-axis and the independent variable is on the…
Q: What is the sequence of DNADNA strand being synthesized during sequencing? Express answer as a…
A: Gel electrophoresis is used to separate molecules like DNA, RNA or protein, for RNA and DNA agarose…
Q: Discuss the differences in the structural features of B DNA and ZDNA.
A: DNA or deoxyribonucleic acid is a nucleic acid made up of two polynucleotide chains that coiled…
Q: Which of the following is not a function of single-strand binding proteins? O prevents reformation…
A: SSBPs : Also called the single-strand binding proteins are a key component of the DNA replication…
Q: If DNA of a particular species was analyzed and it was found that it contains 27 percent A, what…
A: The chemical building blocks of DNA is called nucleotides. These building blocks has three parts - a…
Q: On paper, replicate the following segment of DNA: (UPLOAD PHOTO OF YOUR ANSWER) 5' ATCGG CTACGITCAC…
A: Replication is the process of making two similar DNA units from a double-stranded DNA molecule.…
Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…
A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…
Q: TBP is a eukaryotic DNA binding protein that specifically recognizes the Pribnow box. True False
A: Introduction: The TATA box binding protein provides instructions for making a protein called TATA…
Q: Differeniate elaborately between TWO of the following pairs: a) genetic and restriction map b)…
A: Biotechnology is a field of applied science that involves the use of living organisms and their…
Q: In a specific step for PCR, the single-stranded DNA attaches x to primer sequences complementary to…
A: The steps of PCR are - Step 1: Denaturation The DNA double helix separates due to rise in…
Q: Why doesn't the CRISPR system cut the bacterium's own DNA, at the point in its genome where it…
A: CRISPR is an acronym for Clustered Regularly Interspaced Short Palindromic Repeat. This name refers…
Q: Which of the following process generates a new copy of the transposable element at a new location of…
A: Transposition is a DNA recombination reaction that results in the translocation of a discrete DNA…
Q: what do you understand by a "reading frame"? in case of dsDNA molecule, how many reading frames are…
A: DNA, also known as deoxyribonucleic acid, is a polymer of deoxyribonucleotides linked by…
Q: Match the term with the correct description. satDNA STRs…
A: INTRODUCTION Tandem repeats These are short segments of DNA that can repeat many times within a…
Q: In the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging…
A: The fragments of DNA synthesized by DNA polymerases during lagging strand synthesis are described as…
Q: Given the following ssDNA, what would be the complementary strand for it to be dsDNA?…
A: Both strands of DNA are complementary to each other. Adnan bond with thymine via double bond however…
Q: When different individuals within a population have different numbers of restriction sites within…
A: Introduction: A restriction site in DNA is a group of 6–8 base pairs that a restriction enzyme…
Q: What is the difference between BDNA and Z-DNA?
A: DNA has many configurations in which it occurs. These configurations are- A-DNA, B-DNA, C-DNA, and…
Q: Jerome Vinograd found that when circular DNA from apolyoma virus is subjected to cesium chloride…
A: Polyoma virus is the virus that infect the human and establish symbiotic relationship with humans to…
Q: Chargaff rule applies to a ss RNA b All Polynucleotides c ssDNA d dsDNA
A: Chargaff rule was stated by Austrian born chemist Erwin Chargaff. The specifies about the 1:1 ratio…
Q: Which of the following process occurs between DNA molecules of very similar sequences?a) Homologous…
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains coded genetic material in the…
Q: What is a? 3' 5' a b. 5' d 3' e f a 5' 3' .3' 5' Select an answer and submit. For keyboard…
A: Answer : Option (a) template strand is right answer. a is template strand.
Q: The following bacterial DNA genome is composed of three sequences: TGGCGGT / ACGTTAC / GGATAGG Using…
A: Clustered regularly interspaced short palindromic repeats or CRISPR is a family of nucleotide…
Q: Which Class I element has likely experienced the greatest accumulation of mutations compared to its…
A: Transposable elements are the Jumping genes which are the mobile genetic material within the genome.…
Q: In which sequencing method, DNA is labelled and then chemically cleaved in a sequence-dependent…
A: DNA sequencing refers to decoding the base sequence of the DNA strand. It tells us the base…
Q: Mark the odd one w.r.t. type of genetic material of the given organisms. 1. Escherichia coli 2.…
A: Answer: Introduction: Escherichia coli contains a double stranded DNA as its genetic material. The…
Q: Griffith discovered a “transforming factor” in bacteria that conveyed infectiousness in 1928. In…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: After the students identified the correct model, they did additional research on how DNADNA is…
A: DNA replication is the process by which double-stranded DNA is unwinded to produce two daughter…
Q: Which of the following process occurs in regions where no large –scale sequence similarity is…
A: Recombination is defined as process of breaking down of DNA and recombining into different allelic…
Q: Which of the following occurs between particular short sequences present on otherwise dissimilar…
A: The genetic recombination is the process of exchange of genetic material between two different…
Q: The following individuals contributed to the discovery of DNA. Research. what their contribution(s)…
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: In the diagram below, identify the DNA by clicking on the correct highlighted portion. TACGGGCTA
A: J.D Watson and F.H.C.Crick (1935) proposed a double helix model of DNA molecule, this is the widely…
Q: The FISH technique allows researchers to localize specificDNA sequences with respect to chromosomal…
A: Fluorescence in situ hybridization (FISH) is cytogenetic technique used by researchers to detect and…
Q: Use the set of gene sequencing results below to answer the question that follows: A G C T -Wells I…
A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…
Q: In a dsDNA, a pyrimidine in one chain is always paired with a purine on the other chain because of…
A: Introduction : An organism's DNA is the molecule that holds the genetic information that governs its…
Q: Which of the following statements is true about DNA molecule migration through a gel? Group of…
A: Agarose gel electrophoresis Agarose gel electrophoresis is a method to separate DNA or RNA…
Q: Find the connection among the words below and choose the letter of the word which is different.* 1.…
A: Introduction: Gel electrophoresis is a process used for separation of DNA, RNA or protein mixtures…
Q: The most usefulplasmids contain a _______, which is a short, syntheticDNA sequence that contains a…
A: Plasmid fingerprinting is performed in many organisms like Escherichia coli, Salmonella,…
Q: DNA was extracted from a bacterial species. The proportion of cytosine was found to be 30%, then…
A: There are four nitrogenous bases present in the DNA molecule. These are adenine, guanine, thymine,…
Q: BamHI KpnI SpeI XhoI PatI HindIII 400 500 200 300 700 NotI 75 2580 ECORI Frog DNA BamHI 575 KpnI…
A: Introduction When A Genetically Changed Vector Is Introduced And Incorporated Into The Genome Of An…
Q: According to the genome structure, classify SARS-CoV-2 a. ss DNA b. ds DNA c. ss RNA d. ds RNA
A: A virus is a minuscule infectious agent that multiplies solely within an organism's live cells. From…
Q: The sizes of the restriction fragments produced by cutting bacteriophage lambda DNA (48,502 bp) with…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
As the helicase unwinds the dsDNA, which protein avoids annealing of the newly separated ssDNA molecules.
Step by step
Solved in 2 steps
- Name three intermolecular forces that stabilize the shape ofbDNA, and explain how they act.what do you understand by a "reading frame"? in case of dsDNA molecule, how many reading frames are possible? explain.Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
- In three sentences describe how Sanger sequencing worksIn a dsDNA, a pyrimidine in one chain is always paired with a purine on the other chain because of this arrangement, the molecule is 2nm wide along its entire length. Example is A with G or C with T. True FalseDescribe the process of cloning a DNA fragment into theEcoRI site of the Charon 4 vector. by drawing
- The FISH technique allows researchers to localize specificDNA sequences with respect to chromosomal bands or tovisualize entire chromosomes to facilitate_____________interpretationReferring to Figure 7-20, answer the following questions:a. What is the DNA polymerase I enzyme doing?b. What other proteins are required for the DNApolymerase III on the left to continue synthesizingDNA?c. What other proteins are required for the DNApolymerase III on the right to continue synthesizingDNA?Let’s suppose a bacterialDNA molecule is given a left-handed twist. How does this affect thestructure and function of the DNA?
- Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total DNAisolated from human tissue would be mtDNA?What is the DNA template of the following DNA coding: ATGGCTAACCTTGTAIn the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging strand prior to the action ofDNA polymerase I. The lagging strand contains three Okazakifragments. The RNA primers, which are shown in red, have not yetbeen removed. A. Which Okazaki fragment was made first, the one on the left orthe one on the right?B. Which RNA primer will be the first one to be removed by DNApolymerase I, the primer on the left or the primer on the right?For this primer to be removed by DNA polymerase I and for thegap to be filled in, is it necessary for the Okazaki fragment inthe middle to have already been synthesized? Explain.C. Let’s consider how DNA ligase connects the left Okazaki fragmentwith the middle Okazaki fragment. After DNA polymerase Iremoves the middle RNA primer and fills in the gap with DNA,where does DNA ligase function? See the arrows on either sideof the middle RNA primer. Is ligase needed at the left arrow, atthe right arrow, or both?D. When…