There was a mix of virus and E.coli DNA thats isolated and separated . One DNA sample had a base composition of 22% C, 24% A, 23% G, and 31% T. The other (Sample 2) had a base composition of 25% C, 25% A, 25% G, and 25% T. What is DNA1 and 2? single/double with viral or bacteria dna

There was a mix of virus and E.coli DNA thats isolated and separated . One DNA sample had a base composition of 22% C, 24% A, 23% G, and 31% T. The other (Sample 2) had a base composition of 25% C, 25% A, 25% G, and 25% T. What is DNA1 and 2? single/double with viral or bacteria dna

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 9SQ

See similar textbooks

Related questions

Q: 1. An image of a DNA profile is shown below. The size marker fragments are not shown, but the size…

A: STR stands for Short Tandem Repeat . This analysis is a common molecular biology method. It is used…

Q: A ssDNA solution is diluted by taking 3uL of a stock solution, which is made up to 60uL with water.…

A: Beer-Lambert law relates the attenuation of light to the properties of the material through which…

Q: Which 2 primers will copy the entire sequence of DNA: 5'…

A: Primer is a short nucleotide sequence which is required to initiate DNA replication . To the primers…

Q: You have 2 solutions of DNA. Solution 1 contains single stranded viral DNA while Solution 2 has…

A: DNA is deoxyribonucleic acid. It comprises nucleotide bases, deoxyribose sugar, and the phosphate…

Q: The DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the…

A: chargaff's rule states that in DNA sequence in complementary strands the Adenine will form a bond…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: (Note: According to given guidelines, we are supposed to answer only 3 subparts. Please repost other…

Q: A K I D H

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: E. coli cells grown on 15N medium are transferred to 14N mediumand allowed to grow for two more…

A: Deoxy ribonucleic acid (DNA) replication is semi-conservative in mature, which implies that each of…

Q: 4. The image below is based on the Meselson Stahl experiment where bacteria are grown in 15N and…

A: The Meselson-Stahl experiment showed that DNA replication is a semiconservative process. In this…

Q: you performed a sanger sequencing on a particular segment of DNA. Explain at the molecular level…

A: Effect on gel profile when we either forgot to add ddNTPs Or add more ddNTPs in test tubes during…

Q: B: Lambda DNA/Hindlll Marker, 2 GeneRuler" 1 kb DNA Ladder O'GeneRuler" 1 kb DNA Ladder,…

Q: If 20% of a culture of human cells have a DNA content somewhere between 1 and 2xs (S-phase = 8…

A: Generation time is the duration of time in which a population of cells doubles itself.

Q: A researcher wants to cut this piece of linear DNA. 5'…

A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…

Q: DNA ladder 1 DNA ladder 2 bp ng/Sul 10000 8000 40 40 6000 3000 40 4000 40 700 600 3000 40 500 -2000…

A: Agarose gel electrophoresis is used to separate DNA molecules.

Q: 2. A plasmid was digested with the enzymes BamHI, ECORI, and HindIII. A single digest was performed…

A: A restriction map describes the location of all the restriction sites on a DNA (deoxyribonucleic…

Q: Chargaff's Rule implies the percentage of adenine-thymine pairs and the percentage of…

A: The nucleic acid DNA is composed of 4 types of nucleotides - Adenine (A), Guanine (G), Thymine (T),…

Q: In the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging…

A: The fragments of DNA synthesized by DNA polymerases during lagging strand synthesis are described as…

Q: Please draw the DNA denaturation (DNA melting) curves corresponding to the three molecules and…

A: DNA denaturation is the breaking down of DNA molecule, for comparison or sequencing. DNA can be…

Q: A. Use this data to generate a circular map of the plasmid. Pst I: 10 kb Bam HI: 10 kb Sal I:…

A: Restriction endonucleases are enzymes that cut DNA at specific sites. Restriction endonucleases…

Q: Given the following ssDNA, what would be the complementary strand for it to be dsDNA?…

A: Both strands of DNA are complementary to each other. Adnan bond with thymine via double bond however…

Q: You analyze the nitrogenous bases present in a piece of DNA that is 50 basepairs long. You count 19…

A: The piece of DNA mentioned here is 50 basepairs long with 19 thymine bases.

Q: Bacteriophages are viruses that infect bacteria. Depending on the bacteriophage, their genome can be…

A: Nucleotides are defined as the monomeric units that acts as the building block for producing nucleic…

Q: A plasmid comprised of B-DNA changed its linking number from 420 to 457, resulting in a superhelix…

A: Introduction: DNA in the cell must be arranged in order to allow the packing of large DNA molecules…

Q: Single stranded binding protein A coats ss DNA to keep it single stranded b bind double…

A: Single-strand DNA-binding protein (SSB) is a protein found in Escherichia coli (E. coli) bacteria.…

Q: _1. Bacterial proteins that have the ability to cut both strands of the DNA molecule at certain…

A: DNA and RNA are the two main forms of nucleic acids. Nucleotides, which have a five-carbon sugar…

Q: a b A-T (FT169) Vector IR (10 Gy): WT Wortmannin: IR (10 Gy) cap T2609 «DNA-PKcs 1 2 3 1 2 3 4 Ku80…

A: Phosphorylation of a molecule is the process of attachment of phosphoryl group.

Q: DNA is isolated from an unknown virus. The (A+G)/(T+C) ratio is measured at 0.6. A) Is the genome…

A: Chargaff rule Chargaff rule state that the ratio of pyrimidine and purines should be 1:1. In simple…

Q: Which of the following statements is false? a) the bacterial chromosome is usually circular b) the…

A: Bacteria contain one single molecule of DNA which is usually circular and that constitutes the whole…

Q: If you have five test tubes each containing a double stand DNA, which of the following double…

A: Answer- The denaturation of DNA is depend on the melting temperature and the composition of the…

Q: The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is…

A: Eukaryotic DNA is enclosed within a double membrane bound nucleus. In eukaryotic transcription,…

Q: Which of the sequences below would serve as a PCR primer that would bind this DNA strand: 5'-…

A: PCR is polymerase chain reaction. It is a method of DNA amplification developed by Kerry Mullis.…

Q: our lab is preparing some samples for analysis and loses the labels on the tubes. The samples…

A: A nitrogenous base is a molecule that contains nitrogen and has the chemical properties of a…

Q: Below is a double stranded DNA molecule with a replication bubble. The filled lines represent the…

A: DNA replication refers to an enzyme-mediated complex process that produces replicate or copies of…

Q: If hybrid DNA is allowed to replicate for one generation in medium containing N15 and for second…

A: DNA belongs to the family of biomacromolecules known as nucleic acids that are formed of…

Q: Which of the following is/are not required for DNAreplication to occur?a. DNA polymerase d.…

A: DNA (short for deoxyribonucleic acid) is a double helical structure (with two DNA strands). A…

Q: One strand of a DNA molecule has the base sequence 5’-CACTTA-3’. The complementary base sequence on…

A: Deoxyribonucleic acid (DNA) is defined as an organic chemical molecule that will contain all the…

Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. B…

A: B- DNA is the most common form of DNA. It is the right-handed helix and is present in humans which…

Q: After the students identified the correct model, they did additional research on how DNADNA is…

A: DNA replication is the process by which double-stranded DNA is unwinded to produce two daughter…

Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…

A: the genome is never a static entity, it constantly undergoes changes in its sequence either due to…

Q: (kbp) (bp) 4. To the right is an image of an agarose gel. Lanes 1 and 4 are DNA markers (DNA sizes…

A: Agarose gel electrophoresis is the process by which DNA fragments are run on the basis of their…

Q: In a transformation experiment involving a recipientbacterial strain of genotype a- b-, the…

A: Introduction: According to the idea of genetic linkage, genes that are far apart or on distinct…

Q: The gel profile has plasmid DNA digested by different restriction enzymes in lanes 1 to 4 (left to…

A: First option is incorrect because in the given diagram of plasmid DNA gel profile the DNAs in lanes…

Q: Below are some nucleotide sequences located on a segment of one strand of DNA, from the 5'to the 3'…

A: Step 1 All nucleic acids are made up of nucleotides and in DNA (deoxyribonucleic acid), each…

Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B=3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…

A: A hairpin loop has a stem that contains complementary bases and a circular structure that does not…

Q: Did your recombinant DNA have more than one insert? What was the orientation of the insert(s)? Make…

A: *Recombinant DNA technology is to transfer genes from one organism to another or changing genes by…

Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…

A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…

Q: Will an unknown/experimental virus DNA sample is applied to a Vicrochip DNA microrray stick to one…

A: DNA microarrays are identified as important tools in the clinical medicine and diagnostics field.…

Q: DNA was extracted from a bacterial species. The proportion of cytosine was found to be 30%, then…

A: There are four nitrogenous bases present in the DNA molecule. These are adenine, guanine, thymine,…

Q: BamHI KpnI SpeI XhoI PatI HindIII 400 500 200 300 700 NotI 75 2580 ECORI Frog DNA BamHI 575 KpnI…

A: Introduction When A Genetically Changed Vector Is Introduced And Incorporated Into The Genome Of An…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

There was a mix of virus and E.coli DNA thats isolated and separated . One DNA sample had a base composition of 22% C, 24% A, 23% G, and 31% T. The other (Sample 2) had a base composition of 25% C, 25% A, 25% G, and 25% T. What is DNA1 and 2? single/double with viral or bacteria dna

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Jerome Vinograd found that when circular DNA from apolyoma virus is subjected to cesium chloride gradientcentrifugation, it separates into two distinct bands, oneconsisting of supercoiled DNA and the other of relaxedDNA. Explain how you would identify each band.
Which of the following would represent a section of DNA with a palindromic sequence? 5' TAT CCG 3' 5' GGA CTT 3' 5' TTT CCA 3' 5' CAT ATG 3'
The following data is from the analysis of a circular piece of DNA (plasmid). A. Use this data to generate a circular map of the plasmid. Pst I: 10 kb Bam HI: 10 kb Sal I: 4.5, 3, 2.5 Sal I + Pst I: 4.5, 3, 2, 0.5 Pst I + Bam HI: 7, 3 Sal I + Bam HI: 4.5, 2.5, 2, 1 B. You have purified the 3 kb Pst I to Bam HI fragment of DNA and have labelled the DNA for use in a Southern blot. If the double cuts are shown were run on a gel, transferred to nitrocellulose, and then analyzed by probe hybridization; which band or bands from each double-cut would be identified?
After the students identified the correct model, they did additional research on how DNADNA is replicated. The students then returned to the models that they drew and made the following claims. Student 1: The model does not need to be changed because DNADNA replication can occur without proteins.Student 2: Proteins need to be added to the model. Without proteins, DNADNA replication would not be possible. Which of the following statements indicates the correct student claim and provides the appropriate reasoning?
*note: in the above figure, the top thick white lines are the “wells”, not bands of DNA*
If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? 5'-TGACTAACTG-3' 3'-TGACTAACTG-5' 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5'
You have four tubes with buffer, primer, DNA polymerase, template, and dNTP's. In tube A, you have added radioactive ddATP at a ratio of 1 ddATP/100 dATP. In tube T, you have added radioactive ddTTP at a ratio of 1 ddTTP/100 dTTP. In tube G, you have added radioactive ddGTP at a ratio of 1 ddGTP/100 dGTP. In tube C, you have added radioactive ddCTP at a ratio of 1 ddCTP/100 dCTP. Here is a picture of the template and based paired primer. Each tube has millions of these base paired constructs. 5' - CTAGTACTGA 3' - GATCATGACTGGACTTTGGACTAGCTACAAAGTACGAGTAGAACTAGC After allowing for DNA synthesis and after denaturing the double strand DNA and after separating the single strand DNA by size in a polyacrylamide gel with the A, T, G, and C tube contents in separate lanes, and after performing autoradiography, you detect bands in the A, T, G, and C lanes. In which lane do you expect to see the smallest band? The G lane The C lane The A lane The T lane asap please.
E. coli cells grown on 15N medium are transferred to 14N mediumand allowed to grow for two more generations (two rounds ofDNA replication). DNA extracted from these cells is centrifuged.What density distribution of DNA would you expect in thisexperiment?(A) one high-density and one low-density band(B) one intermediate-density band(C) one high-density and one intermediate-density band(D) one low-density and one intermediate-density band
To make the recombinant plasmid permeable to DNA molecules, which of the chemicals is added?a) MgCl2b) CaCl2c) NaCld) HCl
In the lanes with the vector plasmid (lanes 7 and 8) label bands on the “sample” get that correspond to the following DNA forms: supercooled circles, relaxed circles, linear plasmid, and concatemers.
The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is shown which is ok for our purposes (but remember that the other strand would also be present in DNAà but it is ok for us to ignore). This is very similar to a problem on the old tests. For each letter state the structure or the function of what occurs at that region. Letter A is Letter B is Letter C is Letter D is Letter E is Letter F is Letter G is To which region/letter would RNA Polymerase bind To which region/letter GTF bind Label the position of the start codon ATG and the stop codon TGA The picture below is for the question itself
You Purified plasmid DNA (a 6.0 kb vector) and got the following results... DNA conc: 200 ng/µL A260/280: 1.97 A260/230: 2.15 How would you to set up a ligation reaction with 50 ng of digested DNA and a 1254 base pair PCR insert present at a concentration of 23 ng/µL. How should you pipet the necessary nucleotide components (vector and PCR insert) to obtain a 1:5 vector to insert molar ratio? Keep in mind limitations of pipets when giving your answer.(e.g. Pipetes won't go below 0.5µL)